Incidental Mutation 'R2005:Tasp1'
ID225329
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139977678 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 202 (K202Q)
Ref Sequence ENSEMBL: ENSMUSP00000096907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046656
AA Change: K202Q

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: K202Q

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099304
AA Change: K202Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033
AA Change: K202Q

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110079
AA Change: K202Q

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: K202Q

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124949
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATCGGCTCTGCTTTAATACACAC -3'
(R):5'- CCCTCAGTTTATAAACTCATGCTG -3'

Sequencing Primer
(F):5'- CGGCTCTGCTTTAATACACACATAAG -3'
(R):5'- TTCAGTGTACATTGGGGAGCC -3'
Posted On2014-08-25