Mutagenetix > Incidental Mutation

Incidental Mutation 'R2038:Sptbn1'

225333

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic

MMRRC Submission

040045-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2038 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30049395-30218175 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to G at 30109293 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

probably null
Transcript: ENSMUST00000006629

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000011877

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102838

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000124231

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022B05Rik	T	C	8: 125,389,762 (GRCm39)	Y54C	probably damaging	Het
Adgrf4	A	T	17: 42,978,754 (GRCm39)	H196Q	probably damaging	Het
Astn1	T	G	1: 158,484,690 (GRCm39)	S918A	probably benign	Het
Cd79a	A	T	7: 24,598,782 (GRCm39)	K110N	probably benign	Het
Cdc34b	C	T	11: 94,633,114 (GRCm39)	Q105*	probably null	Het
Cdh23	T	C	10: 60,148,366 (GRCm39)	D2667G	probably damaging	Het
Clpx	G	A	9: 65,224,775 (GRCm39)	G168R	probably damaging	Het
Col8a2	T	C	4: 126,205,108 (GRCm39)		probably benign	Het
Ddx27	G	A	2: 166,875,675 (GRCm39)	E669K	probably damaging	Het
Dnah8	A	T	17: 30,977,255 (GRCm39)	I2898F	probably damaging	Het
Dus2	T	C	8: 106,775,294 (GRCm39)	Y274H	probably damaging	Het
Dync2h1	A	G	9: 6,967,226 (GRCm39)	S4073P	probably damaging	Het
Dynlrb2	G	A	8: 117,241,549 (GRCm39)	R31Q	possibly damaging	Het
Esyt1	C	T	10: 128,347,820 (GRCm39)	V957I	probably benign	Het
Fhdc1	A	T	3: 84,351,868 (GRCm39)	L1119Q	probably benign	Het
H2-T10	T	C	17: 36,430,317 (GRCm39)	K212E	probably benign	Het
H60b	A	T	10: 22,162,114 (GRCm39)	N113I	probably benign	Het
Hace1	A	C	10: 45,576,721 (GRCm39)	K798Q	probably benign	Het
Hdac7	C	T	15: 97,696,151 (GRCm39)	R631H	probably damaging	Het
Kat7	T	A	11: 95,190,928 (GRCm39)	I153F	probably benign	Het
Lman1	T	C	18: 66,131,681 (GRCm39)	T101A	probably benign	Het
Mapk8	A	T	14: 33,110,893 (GRCm39)	C245*	probably null	Het
Mfhas1	T	A	8: 36,058,431 (GRCm39)	W969R	probably damaging	Het
Mlxipl	A	T	5: 135,135,853 (GRCm39)	D26V	probably damaging	Het
Msh5	A	G	17: 35,265,016 (GRCm39)	V53A	probably benign	Het
Msl2	C	A	9: 100,979,183 (GRCm39)	A519D	probably damaging	Het
Nbeal1	A	G	1: 60,245,503 (GRCm39)	S176G	probably benign	Het
Ninl	T	A	2: 150,817,763 (GRCm39)	K134*	probably null	Het
Or10d1	A	G	9: 39,484,283 (GRCm39)	S91P	probably damaging	Het
Or1e25	T	A	11: 73,494,239 (GRCm39)	Y278N	probably damaging	Het
Or4a68	C	A	2: 89,269,689 (GRCm39)	M311I	probably benign	Het
Pabpn1	T	G	14: 55,134,609 (GRCm39)	I250S	probably damaging	Het
Ppp4r4	G	A	12: 103,542,539 (GRCm39)		probably null	Het
Rad51ap2	T	C	12: 11,507,025 (GRCm39)	S316P	possibly damaging	Het
Scn7a	C	A	2: 66,567,780 (GRCm39)	W271C	probably damaging	Het
Set	T	C	2: 29,960,212 (GRCm39)	S182P	probably benign	Het
Sez6l	T	C	5: 112,620,618 (GRCm39)	T321A	possibly damaging	Het
Sfpq	A	T	4: 126,915,295 (GRCm39)	H29L	unknown	Het
Slc33a1	A	G	3: 63,855,577 (GRCm39)	L356P	probably damaging	Het
Srrd	C	T	5: 112,486,316 (GRCm39)	G179D	probably benign	Het
Taf4b	T	C	18: 14,940,456 (GRCm39)	S312P	probably damaging	Het
Tgfbrap1	A	T	1: 43,093,794 (GRCm39)	L566*	probably null	Het
Tln2	T	A	9: 67,304,935 (GRCm39)	M1L	probably benign	Het
Ttc27	T	C	17: 75,163,497 (GRCm39)	F702L	probably benign	Het
Vmn2r54	C	T	7: 12,363,637 (GRCm39)	G419R	possibly damaging	Het
Vps13b	A	G	15: 35,884,887 (GRCm39)	S3187G	probably damaging	Het
Vps13d	C	A	4: 144,907,685 (GRCm39)		probably null	Het
Vps35l	T	C	7: 118,411,097 (GRCm39)	F677L	probably damaging	Het
Zfp568	A	T	7: 29,688,507 (GRCm39)	E23V	probably null	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30,060,818 (GRCm39)	nonsense	probably null
IGL01098:Sptbn1	APN	11	30,109,385 (GRCm39)	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30,054,623 (GRCm39)	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30,095,979 (GRCm39)	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30,088,496 (GRCm39)	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30,050,659 (GRCm39)	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30,087,427 (GRCm39)	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30,067,871 (GRCm39)	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30,070,990 (GRCm39)	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30,092,129 (GRCm39)	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30,069,491 (GRCm39)	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30,092,293 (GRCm39)	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30,087,239 (GRCm39)	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30,147,747 (GRCm39)	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30,092,247 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30,092,289 (GRCm39)	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30,071,545 (GRCm39)	missense	probably benign
R0389:Sptbn1	UTSW	11	30,089,250 (GRCm39)	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30,099,576 (GRCm39)	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30,095,985 (GRCm39)	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30,100,008 (GRCm39)	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30,088,979 (GRCm39)	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30,067,903 (GRCm39)	missense	probably damaging	1.00
R0708:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30,060,902 (GRCm39)	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30,089,016 (GRCm39)	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30,092,201 (GRCm39)	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30,071,591 (GRCm39)	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30,070,785 (GRCm39)	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30,088,637 (GRCm39)	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30,063,909 (GRCm39)	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30,071,498 (GRCm39)	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30,087,301 (GRCm39)	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30,070,783 (GRCm39)	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30,092,245 (GRCm39)	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30,109,371 (GRCm39)	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30,086,124 (GRCm39)	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30,064,781 (GRCm39)	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30,092,414 (GRCm39)	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30,054,469 (GRCm39)	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30,054,559 (GRCm39)	missense	probably benign	0.02
R2047:Sptbn1	UTSW	11	30,088,360 (GRCm39)	splice site	probably benign
R2312:Sptbn1	UTSW	11	30,104,249 (GRCm39)	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30,169,686 (GRCm39)	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30,090,593 (GRCm39)	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30,087,335 (GRCm39)	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30,092,329 (GRCm39)	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30,089,114 (GRCm39)	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30,169,597 (GRCm39)	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign
R4707:Sptbn1	UTSW	11	30,087,197 (GRCm39)	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30,104,297 (GRCm39)	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30,067,759 (GRCm39)	missense	probably benign
R4824:Sptbn1	UTSW	11	30,068,295 (GRCm39)	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30,092,353 (GRCm39)	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30,074,016 (GRCm39)	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30,063,854 (GRCm39)	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30,071,510 (GRCm39)	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30,087,364 (GRCm39)	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30,050,520 (GRCm39)	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30,087,560 (GRCm39)	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30,093,174 (GRCm39)	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30,094,113 (GRCm39)	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30,095,941 (GRCm39)	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30,095,925 (GRCm39)	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30,073,978 (GRCm39)	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30,086,136 (GRCm39)	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30,074,873 (GRCm39)	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30,068,464 (GRCm39)	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30,087,403 (GRCm39)	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30,109,443 (GRCm39)	nonsense	probably null
R6226:Sptbn1	UTSW	11	30,086,054 (GRCm39)	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30,089,429 (GRCm39)	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30,074,030 (GRCm39)	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30,067,859 (GRCm39)	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30,064,787 (GRCm39)	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30,096,777 (GRCm39)	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30,088,634 (GRCm39)	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30,092,187 (GRCm39)	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30,050,633 (GRCm39)	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30,053,323 (GRCm39)	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30,087,119 (GRCm39)	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30,064,859 (GRCm39)	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30,067,798 (GRCm39)	nonsense	probably null
R7379:Sptbn1	UTSW	11	30,089,292 (GRCm39)	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30,092,142 (GRCm39)	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30,088,455 (GRCm39)	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30,088,832 (GRCm39)	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30,104,320 (GRCm39)	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30,092,153 (GRCm39)	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30,079,601 (GRCm39)	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30,086,048 (GRCm39)	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30,051,616 (GRCm39)	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30,089,117 (GRCm39)	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30,147,783 (GRCm39)	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30,074,972 (GRCm39)	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30,063,906 (GRCm39)	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30,088,457 (GRCm39)	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30,070,758 (GRCm39)	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30,169,750 (GRCm39)	start gained	probably benign
R8674:Sptbn1	UTSW	11	30,089,352 (GRCm39)	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30,075,009 (GRCm39)	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30,073,869 (GRCm39)	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30,087,526 (GRCm39)	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30,104,356 (GRCm39)	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30,087,551 (GRCm39)	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30,096,803 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30,147,787 (GRCm39)	missense	probably benign	0.13
Z1176:Sptbn1	UTSW	11	30,087,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30,070,659 (GRCm39)	missense	probably benign	0.27
Z1177:Sptbn1	UTSW	11	30,064,734 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCATCAACTAGGGTCTTCCTTAC -3'
(R):5'- GTGAGTTCTCCTCTGCTTACAG -3'

Sequencing Primer
(F):5'- GGGTCTTCCTTACAAAATACACAGG -3'
(R):5'- TGCTTACAGATGAGCGTGAAG -3'

Posted On

2014-08-25