Incidental Mutation 'R2005:Ddx50'
ID225390
Institutional Source Beutler Lab
Gene Symbol Ddx50
Ensembl Gene ENSMUSG00000020076
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 50
SynonymsGU2, RH-II/Gubeta, 8430408E17Rik, 4933429B04Rik
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62615895-62651218 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62640464 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 306 (H306L)
Ref Sequence ENSEMBL: ENSMUSP00000020270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020270]
Predicted Effect probably benign
Transcript: ENSMUST00000020270
AA Change: H306L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020270
Gene: ENSMUSG00000020076
AA Change: H306L

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
low complexity region 58 65 N/A INTRINSIC
Blast:DEXDc 66 104 3e-8 BLAST
low complexity region 105 122 N/A INTRINSIC
DEXDc 153 354 1.97e-52 SMART
HELICc 398 480 1.8e-28 SMART
low complexity region 558 564 N/A INTRINSIC
Pfam:GUCT 568 662 3.7e-31 PFAM
low complexity region 674 728 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219076
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Ddx50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Ddx50 APN 10 62647132 missense probably benign
IGL01955:Ddx50 APN 10 62647183 missense probably benign
IGL02677:Ddx50 APN 10 62616293 missense unknown
IGL03169:Ddx50 APN 10 62621387 critical splice donor site probably null
IGL03372:Ddx50 APN 10 62643330 missense probably benign 0.11
K7371:Ddx50 UTSW 10 62621510 start codon destroyed probably null
R0123:Ddx50 UTSW 10 62621377 splice site probably benign
R0134:Ddx50 UTSW 10 62621377 splice site probably benign
R0318:Ddx50 UTSW 10 62642837 missense probably damaging 1.00
R0731:Ddx50 UTSW 10 62616249 missense unknown
R1244:Ddx50 UTSW 10 62642924 missense probably damaging 1.00
R1429:Ddx50 UTSW 10 62647068 missense possibly damaging 0.45
R2924:Ddx50 UTSW 10 62627594 missense probably damaging 1.00
R3803:Ddx50 UTSW 10 62639944 missense probably damaging 1.00
R3861:Ddx50 UTSW 10 62642946 missense possibly damaging 0.91
R4169:Ddx50 UTSW 10 62640770 nonsense probably null
R4917:Ddx50 UTSW 10 62627671 nonsense probably null
R4918:Ddx50 UTSW 10 62627671 nonsense probably null
R4951:Ddx50 UTSW 10 62634120 missense probably damaging 0.99
R4962:Ddx50 UTSW 10 62642853 missense probably damaging 1.00
R5102:Ddx50 UTSW 10 62640861 missense probably damaging 1.00
R5403:Ddx50 UTSW 10 62647030 missense probably benign
R5648:Ddx50 UTSW 10 62616270 missense unknown
R5899:Ddx50 UTSW 10 62640817 nonsense probably null
R6127:Ddx50 UTSW 10 62621563 unclassified probably null
R6244:Ddx50 UTSW 10 62621566 unclassified probably null
X0026:Ddx50 UTSW 10 62625191 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTACGCTTTGGACTTTC -3'
(R):5'- CCAAGGCTGGATTGGCTAATC -3'

Sequencing Primer
(F):5'- TACCAGGAGACAAGGTAATA -3'
(R):5'- TCTTTCCTTGCAGTTAATCAAATTCG -3'
Posted On2014-08-25