Incidental Mutation 'R2039:Fsd1l'
ID225391
Institutional Source Beutler Lab
Gene Symbol Fsd1l
Ensembl Gene ENSMUSG00000054752
Gene Namefibronectin type III and SPRY domain containing 1-like
SynonymsA230072O16Rik, Csdufd1, Fsd1nl, Ccdc10
MMRRC Submission 040046-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53631471-53707009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53679972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 223 (D223E)
Ref Sequence ENSEMBL: ENSMUSP00000124613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132151] [ENSMUST00000159415] [ENSMUST00000163067] [ENSMUST00000180164]
Predicted Effect probably benign
Transcript: ENSMUST00000132151
AA Change: D223E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000114931
Gene: ENSMUSG00000054752
AA Change: D223E

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159415
AA Change: D223E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124002
Gene: ENSMUSG00000054752
AA Change: D223E

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 360 480 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163067
AA Change: D223E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124613
Gene: ENSMUSG00000054752
AA Change: D223E

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 349 469 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179534
AA Change: D223E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136849
Gene: ENSMUSG00000054752
AA Change: D223E

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 362 479 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180164
AA Change: D223E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136184
Gene: ENSMUSG00000054752
AA Change: D223E

DomainStartEndE-ValueType
BBC 4 130 1.4e-7 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 1.2e-16 PFAM
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
A2m C A 6: 121,659,949 T757K probably benign Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in Fsd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fsd1l APN 4 53682187 missense probably damaging 1.00
IGL01019:Fsd1l APN 4 53694742 missense probably damaging 1.00
IGL01154:Fsd1l APN 4 53701074 missense probably benign 0.01
IGL01359:Fsd1l APN 4 53659601 missense possibly damaging 0.78
IGL01996:Fsd1l APN 4 53647760 missense probably benign 0.00
IGL02192:Fsd1l APN 4 53647754 missense probably benign
IGL02629:Fsd1l APN 4 53686417 missense probably damaging 1.00
R0009:Fsd1l UTSW 4 53687209 missense probably benign 0.01
R0166:Fsd1l UTSW 4 53647664 splice site probably null
R0255:Fsd1l UTSW 4 53694727 missense probably damaging 1.00
R0349:Fsd1l UTSW 4 53679854 missense probably damaging 0.97
R0409:Fsd1l UTSW 4 53679932 missense probably benign 0.00
R1886:Fsd1l UTSW 4 53696984 splice site probably null
R1887:Fsd1l UTSW 4 53696984 splice site probably null
R2289:Fsd1l UTSW 4 53696931 missense possibly damaging 0.64
R4577:Fsd1l UTSW 4 53686397 missense probably damaging 1.00
R5134:Fsd1l UTSW 4 53647766 missense probably benign 0.43
R6073:Fsd1l UTSW 4 53679994 missense probably damaging 1.00
R6216:Fsd1l UTSW 4 53694742 missense probably damaging 1.00
R7184:Fsd1l UTSW 4 53694054 missense probably damaging 1.00
R7285:Fsd1l UTSW 4 53682200 critical splice donor site probably null
R7423:Fsd1l UTSW 4 53686406 missense probably damaging 1.00
R7465:Fsd1l UTSW 4 53647755 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCCAGAGATTGACCCAGTAG -3'
(R):5'- TGCTCTGAAATATTGCTTCCACAG -3'

Sequencing Primer
(F):5'- CAGAGATTGACCCAGTAGAGTGTTTG -3'
(R):5'- TGCCTTACATACACTATGTTAGTAGG -3'
Posted On2014-08-25