Incidental Mutation 'R2039:A2m'
ID225409
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 040046-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2039 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 121659949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 757 (T757K)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203]
Predicted Effect probably benign
Transcript: ENSMUST00000032203
AA Change: T757K

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: T757K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203413
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,284,676 S4167P probably damaging Het
4932438A13Rik T A 3: 37,003,878 F3206I possibly damaging Het
Abca14 T C 7: 120,312,264 V1357A probably damaging Het
Abca5 A G 11: 110,299,929 F785S probably damaging Het
Arntl T G 7: 113,285,112 L119R probably damaging Het
Cacna1h T C 17: 25,391,845 I554V probably benign Het
Cuzd1 T C 7: 131,309,616 S545G probably benign Het
Cuzd1 A T 7: 131,314,914 probably benign Het
Edrf1 T A 7: 133,653,949 Y574* probably null Het
Eef1d T C 15: 75,895,769 D252G probably damaging Het
Efna5 T G 17: 62,881,066 D22A probably benign Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Etl4 T C 2: 20,785,228 S881P probably damaging Het
Exoc3 A G 13: 74,192,977 I236T probably benign Het
Fam19a1 C A 6: 96,654,764 probably null Het
Far2 T C 6: 148,165,577 L320S probably benign Het
Fsd1l T A 4: 53,679,972 D223E probably benign Het
Fut1 C T 7: 45,618,991 A123V possibly damaging Het
Gap43 A T 16: 42,292,352 D15E possibly damaging Het
Gm12789 T C 4: 101,988,986 probably benign Het
Gm5114 T A 7: 39,409,188 T336S probably damaging Het
Hhla1 G A 15: 65,936,377 T273I possibly damaging Het
Hira A G 16: 18,951,701 H812R probably benign Het
Hsp90aa1 T C 12: 110,693,782 N360S probably damaging Het
Kmt2c A G 5: 25,329,040 L1463S possibly damaging Het
Lman2l A G 1: 36,428,454 F171S probably damaging Het
Lrfn5 T C 12: 61,840,323 L299S possibly damaging Het
Msr1 A T 8: 39,589,377 W386R probably damaging Het
Myo1e T C 9: 70,320,133 V162A possibly damaging Het
Npy6r A G 18: 44,276,003 T164A probably benign Het
Olfr677 T C 7: 105,056,390 L48P possibly damaging Het
Rbak C A 5: 143,173,175 V708L probably benign Het
Rev3l A G 10: 39,824,444 I1646V probably damaging Het
Rsrc1 A G 3: 66,994,618 T34A unknown Het
Sept9 G A 11: 117,351,617 V53I probably damaging Het
Snrnp200 G A 2: 127,234,984 A1646T probably benign Het
Sqor G A 2: 122,792,404 probably null Het
St7 T C 6: 17,886,112 Y358H probably damaging Het
Tas2r126 T A 6: 42,434,623 M30K probably benign Het
Thsd7a G A 6: 12,408,923 T700I possibly damaging Het
Ttn T G 2: 76,868,466 probably benign Het
Ugt1a10 T G 1: 88,055,981 I167S probably benign Het
Uhmk1 T C 1: 170,212,267 D88G probably damaging Het
Washc2 T A 6: 116,224,439 F332Y probably damaging Het
Wdr48 T A 9: 119,909,387 W38R probably damaging Het
Zfc3h1 A G 10: 115,406,483 D622G probably damaging Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3429:A2m UTSW 6 121636290 start codon destroyed probably null
R3437:A2m UTSW 6 121639294 missense probably null 0.03
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTACTAAGGTTGAGCAACGTAG -3'
(R):5'- AGGTAGTTCAGCACAGTGGC -3'

Sequencing Primer
(F):5'- CGTAGAAGCCCCCTAGGTTAAATTG -3'
(R):5'- TTCAGCACAGTGGCCTTGAG -3'
Posted On2014-08-25