Incidental Mutation 'R2005:Foxf2'
ID225414
Institutional Source Beutler Lab
Gene Symbol Foxf2
Ensembl Gene ENSMUSG00000038402
Gene Nameforkhead box F2
SynonymsLUN, FREAC2, Fkh20
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2005 (G1)
Quality Score90
Status Not validated
Chromosome13
Chromosomal Location31625816-31631403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31626141 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 21 (R21L)
Ref Sequence ENSEMBL: ENSMUSP00000046789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042054]
Predicted Effect unknown
Transcript: ENSMUST00000042054
AA Change: R21L
SMART Domains Protein: ENSMUSP00000046789
Gene: ENSMUSG00000038402
AA Change: R21L

DomainStartEndE-ValueType
low complexity region 7 27 N/A INTRINSIC
low complexity region 45 94 N/A INTRINSIC
FH 98 188 6.02e-59 SMART
low complexity region 189 198 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
low complexity region 289 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221582
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXF2 encodes forkhead box F2, one of many human homologues of the Drosophila melanogaster transcription factor forkhead. FOXF2 is expressed in lung and placenta, and has been shown to transcriptionally activate several lung-specific genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice do not live through the first day of life due to an inability to suckle, which is secondary to cleft palate and tongue abnormalities. Mice homozygous for an ENU mutation exhibit postnatal lethality without palate defect and abnormal anterior segment dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Foxf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Foxf2 APN 13 31626189 missense unknown
IGL01939:Foxf2 APN 13 31626714 missense probably damaging 0.97
IGL02012:Foxf2 APN 13 31626516 missense probably damaging 0.98
IGL02647:Foxf2 APN 13 31627235 missense probably damaging 0.99
IGL03275:Foxf2 APN 13 31626531 missense probably damaging 0.99
R0517:Foxf2 UTSW 13 31626243 missense unknown
R0812:Foxf2 UTSW 13 31627205 missense probably damaging 0.97
R2090:Foxf2 UTSW 13 31626841 missense probably benign 0.23
R3724:Foxf2 UTSW 13 31630530 missense probably damaging 1.00
R4627:Foxf2 UTSW 13 31626888 missense probably benign 0.40
R4757:Foxf2 UTSW 13 31626189 missense unknown
R5049:Foxf2 UTSW 13 31627175 missense probably benign
R5303:Foxf2 UTSW 13 31626480 missense possibly damaging 0.88
R5874:Foxf2 UTSW 13 31626792 missense probably benign 0.05
R6983:Foxf2 UTSW 13 31627197 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTAGGAGACGGTTGCGCAAG -3'
(R):5'- GTACGAGTAAGGAGGCTTCTC -3'

Sequencing Primer
(F):5'- AAGCCCCAGAGGAGCTG -3'
(R):5'- CCCGAGGTTGCCTTCTTGG -3'
Posted On2014-08-25