Mutagenetix > Incidental Mutation

Incidental Mutation 'R2039:Fut1'

225415

Institutional Source

Beutler Lab

Gene Symbol

Fut1

Ensembl Gene

ENSMUSG00000008461

Gene Name

fucosyltransferase 1

Synonyms

H transferase

MMRRC Submission

040046-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2039 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45266862-45270483 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45268415 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 123 (A123V)

Ref Sequence

ENSEMBL: ENSMUSP00000008605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]

AlphaFold

O09160

Predicted Effect

possibly damaging
Transcript: ENSMUST00000008605
AA Change: A123V

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: A123V

Domain	Start	End	E-Value	Type
transmembrane domain	9	31	N/A	INTRINSIC
Pfam:Glyco_transf_11	39	355	3.1e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000033099

SMART Domains

Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
FGF	44	169	3.95e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000033100

SMART Domains

Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

Domain	Start	End	E-Value	Type
low complexity region	7	13	N/A	INTRINSIC
Pfam:IZUMO	21	166	2.6e-53	PFAM
IG	167	253	2.43e-2	SMART
transmembrane domain	320	342	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209379
AA Change: A68V

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000210150

Meta Mutation Damage Score

0.4854

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	C	A	6: 121,636,908 (GRCm39)	T757K	probably benign	Het
Abca14	T	C	7: 119,911,487 (GRCm39)	V1357A	probably damaging	Het
Abca5	A	G	11: 110,190,755 (GRCm39)	F785S	probably damaging	Het
Bltp1	T	A	3: 37,058,027 (GRCm39)	F3206I	possibly damaging	Het
Bmal1	T	G	7: 112,884,319 (GRCm39)	L119R	probably damaging	Het
Cacna1h	T	C	17: 25,610,819 (GRCm39)	I554V	probably benign	Het
Cuzd1	A	T	7: 130,916,643 (GRCm39)		probably benign	Het
Cuzd1	T	C	7: 130,911,345 (GRCm39)	S545G	probably benign	Het
Edrf1	T	A	7: 133,255,678 (GRCm39)	Y574*	probably null	Het
Eef1d	T	C	15: 75,767,618 (GRCm39)	D252G	probably damaging	Het
Efna5	T	G	17: 63,188,061 (GRCm39)	D22A	probably benign	Het
Esyt1	C	T	10: 128,347,820 (GRCm39)	V957I	probably benign	Het
Etl4	T	C	2: 20,790,039 (GRCm39)	S881P	probably damaging	Het
Exoc3	A	G	13: 74,341,096 (GRCm39)	I236T	probably benign	Het
Far2	T	C	6: 148,067,075 (GRCm39)	L320S	probably benign	Het
Fsd1l	T	A	4: 53,679,972 (GRCm39)	D223E	probably benign	Het
Gap43	A	T	16: 42,112,715 (GRCm39)	D15E	possibly damaging	Het
Gm12789	T	C	4: 101,846,183 (GRCm39)		probably benign	Het
Gm5114	T	A	7: 39,058,612 (GRCm39)	T336S	probably damaging	Het
Hhla1	G	A	15: 65,808,226 (GRCm39)	T273I	possibly damaging	Het
Hira	A	G	16: 18,770,451 (GRCm39)	H812R	probably benign	Het
Hsp90aa1	T	C	12: 110,660,216 (GRCm39)	N360S	probably damaging	Het
Kmt2c	A	G	5: 25,534,038 (GRCm39)	L1463S	possibly damaging	Het
Lman2l	A	G	1: 36,467,535 (GRCm39)	F171S	probably damaging	Het
Lrfn5	T	C	12: 61,887,109 (GRCm39)	L299S	possibly damaging	Het
Msr1	A	T	8: 40,042,418 (GRCm39)	W386R	probably damaging	Het
Myo1e	T	C	9: 70,227,415 (GRCm39)	V162A	possibly damaging	Het
Npy6r	A	G	18: 44,409,070 (GRCm39)	T164A	probably benign	Het
Or52e4	T	C	7: 104,705,597 (GRCm39)	L48P	possibly damaging	Het
Rbak	C	A	5: 143,158,930 (GRCm39)	V708L	probably benign	Het
Rev3l	A	G	10: 39,700,440 (GRCm39)	I1646V	probably damaging	Het
Rsrc1	A	G	3: 66,901,951 (GRCm39)	T34A	unknown	Het
Septin9	G	A	11: 117,242,443 (GRCm39)	V53I	probably damaging	Het
Snrnp200	G	A	2: 127,076,904 (GRCm39)	A1646T	probably benign	Het
Spata31h1	A	G	10: 82,120,510 (GRCm39)	S4167P	probably damaging	Het
Sqor	G	A	2: 122,634,324 (GRCm39)		probably null	Het
St7	T	C	6: 17,886,111 (GRCm39)	Y358H	probably damaging	Het
Tafa1	C	A	6: 96,631,725 (GRCm39)		probably null	Het
Tas2r126	T	A	6: 42,411,557 (GRCm39)	M30K	probably benign	Het
Thsd7a	G	A	6: 12,408,922 (GRCm39)	T700I	possibly damaging	Het
Ttn	T	G	2: 76,698,810 (GRCm39)		probably benign	Het
Ugt1a10	T	G	1: 87,983,703 (GRCm39)	I167S	probably benign	Het
Uhmk1	T	C	1: 170,039,836 (GRCm39)	D88G	probably damaging	Het
Washc2	T	A	6: 116,201,400 (GRCm39)	F332Y	probably damaging	Het
Wdr48	T	A	9: 119,738,453 (GRCm39)	W38R	probably damaging	Het
Zfc3h1	A	G	10: 115,242,388 (GRCm39)	D622G	probably damaging	Het

Other mutations in Fut1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Fut1	APN	7	45,268,855 (GRCm39)	missense	probably damaging	1.00
IGL02015:Fut1	APN	7	45,268,399 (GRCm39)	missense	probably damaging	0.98
IGL02232:Fut1	APN	7	45,268,871 (GRCm39)	missense	probably damaging	1.00
IGL02934:Fut1	APN	7	45,268,127 (GRCm39)	missense	possibly damaging	0.49
IGL02976:Fut1	APN	7	45,268,744 (GRCm39)	missense	probably damaging	1.00
IGL03091:Fut1	APN	7	45,268,951 (GRCm39)	missense	probably damaging	1.00
IGL03169:Fut1	APN	7	45,268,457 (GRCm39)	missense	probably benign	0.05
R0107:Fut1	UTSW	7	45,268,270 (GRCm39)	missense	possibly damaging	0.50
R0107:Fut1	UTSW	7	45,268,270 (GRCm39)	missense	possibly damaging	0.50
R1413:Fut1	UTSW	7	45,268,852 (GRCm39)	missense	probably damaging	0.98
R2403:Fut1	UTSW	7	45,268,643 (GRCm39)	missense	probably benign	0.14
R2516:Fut1	UTSW	7	45,268,622 (GRCm39)	missense	probably benign	0.03
R3429:Fut1	UTSW	7	45,268,798 (GRCm39)	missense	probably damaging	1.00
R3430:Fut1	UTSW	7	45,268,798 (GRCm39)	missense	probably damaging	1.00
R5775:Fut1	UTSW	7	45,268,886 (GRCm39)	missense	probably damaging	1.00
R6244:Fut1	UTSW	7	45,268,730 (GRCm39)	missense	possibly damaging	0.79
R6961:Fut1	UTSW	7	45,268,963 (GRCm39)	missense	probably damaging	0.99
R7052:Fut1	UTSW	7	45,269,181 (GRCm39)	makesense	probably null
R8027:Fut1	UTSW	7	45,268,289 (GRCm39)	missense	probably damaging	1.00
Z1177:Fut1	UTSW	7	45,268,653 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCATTGCAGACATCTAATGGC -3'
(R):5'- CCGTAGATGGTTATGCAGAGTG -3'

Sequencing Primer
(F):5'- GACATCTAATGGCTCCCCTTC -3'
(R):5'- TGCAGAGTGAATTCCCTACG -3'

Posted On

2014-08-25