Incidental Mutation 'R2005:Tgds'
ID225426
Institutional Source Beutler Lab
Gene Symbol Tgds
Ensembl Gene ENSMUSG00000022130
Gene NameTDP-glucose 4,6-dehydratase
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location118111911-118132755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118130656 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 35 (V35A)
Ref Sequence ENSEMBL: ENSMUSP00000022727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022727] [ENSMUST00000227350] [ENSMUST00000228543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022727
AA Change: V35A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022727
Gene: ENSMUSG00000022130
AA Change: V35A

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 18 333 2.9e-27 PFAM
Pfam:Epimerase 20 258 3.2e-61 PFAM
Pfam:Polysacc_synt_2 20 300 2.6e-27 PFAM
Pfam:3Beta_HSD 21 248 3.2e-29 PFAM
Pfam:GDP_Man_Dehyd 21 327 2.3e-77 PFAM
Pfam:NAD_binding_4 22 230 9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227350
AA Change: V35A

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228085
Predicted Effect probably benign
Transcript: ENSMUST00000228543
AA Change: V35A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the short-chain dehydrogenases/reductases (SDR) superfamily, and is thought to contain a nicotinamide adenine dinucleotide (NAD) binding domain. This large SDR family of enzymes is involved in the metabolism of a variety of compounds, including prostaglandins, retinoids, lipids, steroid hormones, and xenobiotics. Mutations in this gene have been associated with Catel-Manzke syndrome, which is characterized by Pierre Robin sequence, and radial deviation of the index finger due to the presence of an accessory bone between the index finger and its proximal phalanx. Pierre Robin sequence is defined by an undersized jaw, backwards displacement of the tongue base that causes an obstruction of the airways, and can also be associated with a cleft palate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Tgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Tgds APN 14 118128214 splice site probably benign
IGL01521:Tgds APN 14 118113094 missense probably damaging 1.00
IGL01928:Tgds APN 14 118116129 missense probably benign 0.04
IGL02134:Tgds APN 14 118113122 missense probably benign 0.03
IGL03353:Tgds APN 14 118127507 nonsense probably null
R0079:Tgds UTSW 14 118116235 missense possibly damaging 0.76
R2104:Tgds UTSW 14 118121737 nonsense probably null
R4676:Tgds UTSW 14 118116231 missense probably benign 0.01
R4801:Tgds UTSW 14 118117033 intron probably benign
R4992:Tgds UTSW 14 118117763 missense probably damaging 1.00
R5051:Tgds UTSW 14 118128227 missense probably damaging 1.00
R5083:Tgds UTSW 14 118116079 splice site probably null
R5802:Tgds UTSW 14 118132707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATGCAGACCCTGAGAGG -3'
(R):5'- CAGGCAGTTTTATGTGGCACAG -3'

Sequencing Primer
(F):5'- TGAGAGGCTGGGACGACC -3'
(R):5'- TTTTATGTGGCACAGGGAAGATAC -3'
Posted On2014-08-25