Incidental Mutation 'R2005:Pde10a'
ID225450
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 8929091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably null
Transcript: ENSMUST00000024647
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089085
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115715
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably null
Transcript: ENSMUST00000115720
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115724
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136160
Predicted Effect probably null
Transcript: ENSMUST00000149440
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000231430
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
buzzed UTSW 17 8930537 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3721:Pde10a UTSW 17 8969589 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGATAGTTCAGTTTCAAGTCTC -3'
(R):5'- GTTTCCACTTCAGACTGAGCC -3'

Sequencing Primer
(F):5'- AAGTCTCCCTGTTTTACAAGTGG -3'
(R):5'- GGTGATGAAGAGTCCCATTCC -3'
Posted On2014-08-25