Incidental Mutation 'R2005:Crebrf'
ID225456
Institutional Source Beutler Lab
Gene Symbol Crebrf
Ensembl Gene ENSMUSG00000048249
Gene NameCREB3 regulatory factor
SynonymsA930001N09Rik
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location26715650-26776635 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26742883 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 318 (V318A)
Ref Sequence ENSEMBL: ENSMUSP00000114274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062519] [ENSMUST00000142539] [ENSMUST00000144221] [ENSMUST00000151681]
Predicted Effect probably benign
Transcript: ENSMUST00000062519
AA Change: V326A

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000059102
Gene: ENSMUSG00000048249
AA Change: V326A

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
low complexity region 356 407 N/A INTRINSIC
Blast:BRLZ 520 584 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132972
Predicted Effect possibly damaging
Transcript: ENSMUST00000142539
AA Change: V318A

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114274
Gene: ENSMUSG00000048249
AA Change: V318A

DomainStartEndE-ValueType
low complexity region 309 322 N/A INTRINSIC
low complexity region 348 399 N/A INTRINSIC
Blast:BRLZ 512 576 3e-35 BLAST
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144221
AA Change: V326A

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120212
Gene: ENSMUSG00000048249
AA Change: V326A

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151681
SMART Domains Protein: ENSMUSP00000119186
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
Blast:BRLZ 100 137 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired social recognition, increased vertical and horizontal activity, abnormal maternal nurturing, decreased prolactin and corticosterone serum levels, and abnormal mammary gland growth during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tdrd6 A G 17: 43,628,655 F501L probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Crebrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Crebrf APN 17 26743093 missense probably damaging 1.00
IGL03106:Crebrf APN 17 26771319 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0254:Crebrf UTSW 17 26739594 missense probably benign 0.01
R0448:Crebrf UTSW 17 26743102 missense probably benign 0.42
R1268:Crebrf UTSW 17 26739596 frame shift probably null
R1857:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1858:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1937:Crebrf UTSW 17 26742468 missense probably damaging 1.00
R2006:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2031:Crebrf UTSW 17 26742921 missense probably damaging 0.97
R2323:Crebrf UTSW 17 26763607 unclassified probably benign
R2352:Crebrf UTSW 17 26742346 missense probably damaging 1.00
R4510:Crebrf UTSW 17 26742964 missense probably benign
R4511:Crebrf UTSW 17 26742964 missense probably benign
R4585:Crebrf UTSW 17 26762255 missense probably damaging 1.00
R4642:Crebrf UTSW 17 26743061 missense probably benign 0.23
R4896:Crebrf UTSW 17 26742420 missense possibly damaging 0.75
R5227:Crebrf UTSW 17 26759765 missense probably damaging 1.00
R5377:Crebrf UTSW 17 26759865 missense probably damaging 0.99
R5443:Crebrf UTSW 17 26742354 missense probably damaging 1.00
R5540:Crebrf UTSW 17 26742097 missense possibly damaging 0.90
R6017:Crebrf UTSW 17 26757849 missense probably benign 0.04
R6132:Crebrf UTSW 17 26763403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGTGGAGCTGTGGCAAAG -3'
(R):5'- GAACGTGTCGCTGATATCATCATC -3'

Sequencing Primer
(F):5'- TGGAGCTGTGGCAAAGAGACAG -3'
(R):5'- GTGTCGCTGATATCATCATCTCTGTC -3'
Posted On2014-08-25