Incidental Mutation 'R2005:Tdrd6'
ID225458
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission 040014-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2005 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43628655 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 501 (F501L)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably damaging
Transcript: ENSMUST00000045717
AA Change: F501L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: F501L

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168073
AA Change: F501L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: F501L

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,877,827 A961V probably benign Het
Adcy10 A G 1: 165,525,022 Y475C probably benign Het
Adgrb3 T C 1: 25,111,718 M1145V probably benign Het
Akr1c21 A G 13: 4,574,215 T23A probably damaging Het
Ankrd33b A T 15: 31,297,668 S314R probably damaging Het
Apc T C 18: 34,310,909 probably null Het
Atg9a T A 1: 75,185,991 Q460L probably benign Het
Birc3 C T 9: 7,860,341 C292Y probably damaging Het
Capn5 T C 7: 98,129,363 I350V probably benign Het
Cc2d2a G A 5: 43,726,373 probably null Het
Cdh22 T A 2: 165,180,923 E76V probably damaging Het
Cdh8 T C 8: 99,033,471 probably null Het
Cdkn1b ATTCTTCTTC ATTCTTCTTCTTC 6: 134,921,956 probably benign Het
Cfap54 T A 10: 92,884,768 D2608V unknown Het
Crebrf T C 17: 26,742,883 V318A possibly damaging Het
Cwf19l2 A T 9: 3,430,720 N351Y possibly damaging Het
Cyp2c67 A T 19: 39,643,345 M136K probably damaging Het
Ddx10 A G 9: 53,240,475 probably null Het
Ddx47 A G 6: 135,018,121 N92S probably benign Het
Ddx50 T A 10: 62,640,464 H306L probably benign Het
Dnajc27 A G 12: 4,097,317 T167A possibly damaging Het
Dscam T G 16: 97,038,920 K162N probably benign Het
Eif4h G A 5: 134,627,677 T53I probably benign Het
Elmo2 T C 2: 165,298,279 N332S probably benign Het
Ergic3 A G 2: 156,011,108 N157S possibly damaging Het
F2rl1 G T 13: 95,513,274 R367S probably damaging Het
Fbxo36 G A 1: 84,900,069 A151T probably benign Het
Foxf2 G T 13: 31,626,141 R21L unknown Het
Gmip T A 8: 69,814,043 H269Q probably benign Het
Gng4 T A 13: 13,806,166 V32E probably benign Het
Grm3 T C 5: 9,589,793 Y84C possibly damaging Het
Helz2 C T 2: 181,231,329 R2396H probably benign Het
Icosl A T 10: 78,071,953 M116L possibly damaging Het
Itgb3bp A C 4: 99,814,058 N16K probably benign Het
Kcnt2 A G 1: 140,553,018 M824V probably damaging Het
Mki67 T A 7: 135,698,509 K1599* probably null Het
Mmp25 G A 17: 23,640,242 R144W probably damaging Het
Mmrn1 A T 6: 60,976,084 I450F possibly damaging Het
Mroh2b A T 15: 4,917,158 K480M probably damaging Het
Nbn T A 4: 15,979,351 D445E probably benign Het
Npbwr1 T A 1: 5,916,351 S315C probably damaging Het
Olfr1118 T A 2: 87,309,448 S240T probably benign Het
Olfr1166 A G 2: 88,124,547 L146P probably damaging Het
Olfr378 A T 11: 73,425,239 V248E probably damaging Het
Olfr828 G A 9: 18,815,505 S263L probably benign Het
Pard3b A T 1: 62,144,891 E183D probably benign Het
Pde10a G A 17: 8,929,091 probably null Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Prdm13 T C 4: 21,685,695 probably benign Het
Rc3h2 T A 2: 37,389,753 K461* probably null Het
Reep2 C T 18: 34,845,621 T117M probably damaging Het
Rhbdd1 A G 1: 82,340,810 N138S probably benign Het
Rnf19a A T 15: 36,241,770 F708I possibly damaging Het
Robo2 G A 16: 73,933,115 H1069Y possibly damaging Het
Rpl9 C T 5: 65,389,535 V112I probably benign Het
Sec16a A C 2: 26,439,080 S974R probably benign Het
Sfrp5 A G 19: 42,198,836 M265T probably benign Het
Skint7 T C 4: 111,984,850 I305T probably benign Het
Slc6a7 T C 18: 61,001,641 D454G possibly damaging Het
Slco6c1 A G 1: 97,081,489 I407T probably damaging Het
Slfn8 A T 11: 83,004,150 M610K probably damaging Het
Spidr A G 16: 16,048,049 S299P probably damaging Het
Sptbn4 C T 7: 27,366,419 W2034* probably null Het
Stard9 T A 2: 120,664,945 F100L possibly damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stc1 T C 14: 69,031,647 probably null Het
Sun2 T C 15: 79,726,624 E667G possibly damaging Het
Tacc2 T C 7: 130,731,550 S511P probably damaging Het
Tasp1 T G 2: 139,977,678 K202Q probably damaging Het
Tgds A G 14: 118,130,656 V35A possibly damaging Het
Tubgcp6 G A 15: 89,104,166 T860I probably benign Het
Twf1 C T 15: 94,585,447 probably null Het
Vangl1 A G 3: 102,163,466 S385P probably benign Het
Vmn2r117 A G 17: 23,477,644 I263T probably damaging Het
Washc5 A G 15: 59,341,155 L892P possibly damaging Het
Wnk4 T C 11: 101,263,890 C302R probably damaging Het
Zfp395 A G 14: 65,388,885 E191G possibly damaging Het
Zkscan17 A G 11: 59,492,216 L302P probably damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTGCTGTCTAATCGGGTGAC -3'
(R):5'- GTACAATCCTGTTGCCTGGC -3'

Sequencing Primer
(F):5'- GCTCGGTAATAGCCATTTTCTTTC -3'
(R):5'- CTGACTGGTTTCTTCAGAGCCAG -3'
Posted On2014-08-25