Incidental Mutation 'R0145:Sema4a'
ID22550
Institutional Source Beutler Lab
Gene Symbol Sema4a
Ensembl Gene ENSMUSG00000028064
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A
SynonymsSemB, Semab, SemB
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R0145 (G1) of strain 722
Quality Score178
Status Validated (trace)
Chromosome3
Chromosomal Location88435959-88461182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88451422 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 10 (I10N)
Ref Sequence ENSEMBL: ENSMUSP00000138858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000123753] [ENSMUST00000125526] [ENSMUST00000127436] [ENSMUST00000141471] [ENSMUST00000147200] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222] [ENSMUST00000184487] [ENSMUST00000184876] [ENSMUST00000185137]
Predicted Effect probably benign
Transcript: ENSMUST00000029700
AA Change: I164N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107531
AA Change: I32N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: I32N

DomainStartEndE-ValueType
Sema 2 346 2.06e-101 SMART
PSI 364 415 9.33e-13 SMART
transmembrane domain 548 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123753
Predicted Effect probably benign
Transcript: ENSMUST00000125526
SMART Domains Protein: ENSMUSP00000119028
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 113 8.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127436
AA Change: I164N

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118706
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 234 5.5e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135732
Predicted Effect probably benign
Transcript: ENSMUST00000141471
SMART Domains Protein: ENSMUSP00000114330
Gene: ENSMUSG00000028064

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146921
Predicted Effect possibly damaging
Transcript: ENSMUST00000147200
AA Change: I164N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123061
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 203 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149145
Predicted Effect probably benign
Transcript: ENSMUST00000165898
AA Change: I164N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166237
AA Change: I164N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169222
AA Change: I164N

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: I164N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Sema 64 478 1.96e-166 SMART
PSI 496 547 9.33e-13 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184487
AA Change: S170T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139126
Gene: ENSMUSG00000028064
AA Change: S170T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 168 1.5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000184876
AA Change: S180T
SMART Domains Protein: ENSMUSP00000139159
Gene: ENSMUSG00000028064
AA Change: S180T

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Sema 64 179 7.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184972
Predicted Effect probably damaging
Transcript: ENSMUST00000185137
AA Change: I10N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Sema4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Sema4a APN 3 88449810 missense probably damaging 1.00
IGL01722:Sema4a APN 3 88438184 missense probably benign 0.14
IGL01769:Sema4a APN 3 88449756 missense possibly damaging 0.86
IGL02076:Sema4a APN 3 88450522 missense probably damaging 0.99
IGL02202:Sema4a APN 3 88449743 missense probably damaging 1.00
R0386:Sema4a UTSW 3 88436800 missense possibly damaging 0.75
R0837:Sema4a UTSW 3 88453098 missense possibly damaging 0.46
R0863:Sema4a UTSW 3 88448149 unclassified probably benign
R1567:Sema4a UTSW 3 88452046 missense probably damaging 1.00
R1675:Sema4a UTSW 3 88454766 missense possibly damaging 0.66
R1739:Sema4a UTSW 3 88436838 missense possibly damaging 0.94
R1801:Sema4a UTSW 3 88436749 missense probably benign 0.04
R1961:Sema4a UTSW 3 88438176 splice site probably benign
R2029:Sema4a UTSW 3 88451361 missense probably damaging 1.00
R4934:Sema4a UTSW 3 88438261 missense probably damaging 1.00
R5006:Sema4a UTSW 3 88436784 missense probably benign
R5309:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5312:Sema4a UTSW 3 88437036 missense probably damaging 1.00
R5338:Sema4a UTSW 3 88451497 missense probably benign 0.01
R5481:Sema4a UTSW 3 88453040 nonsense probably null
R5510:Sema4a UTSW 3 88449986 critical splice donor site probably null
R6046:Sema4a UTSW 3 88440701 missense probably damaging 1.00
R7242:Sema4a UTSW 3 88450109 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGTAGGCCATTCGAGAGAGTC -3'
(R):5'- CTGTCCTCCGTAGCTTTGGGAATC -3'

Sequencing Primer
(F):5'- GTTAAACAAGTGGCTGAACCTC -3'
(R):5'- GAATCTCTGGTCCCTGCG -3'
Posted On2013-04-16