Incidental Mutation 'R2040:Vmn2r111'
ID225592
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Namevomeronasal 2, receptor 111
SynonymsEG210876
MMRRC Submission 040047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R2040 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22547941-22573273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22548414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 701 (I701F)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
Predicted Effect probably damaging
Transcript: ENSMUST00000092491
AA Change: I701F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: I701F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A T 5: 107,545,741 I75L probably benign Het
Abca2 T C 2: 25,443,805 L1755P probably damaging Het
Adam6b A T 12: 113,490,744 I394L probably benign Het
Ano2 T A 6: 126,039,508 N1001K probably benign Het
Arap2 A T 5: 62,748,916 N253K probably damaging Het
Ascc3 T C 10: 50,728,131 C1316R probably benign Het
Atox1 T C 11: 55,450,517 Y64C probably benign Het
Atp13a1 A G 8: 69,807,052 T1098A possibly damaging Het
Casr T C 16: 36,510,366 E202G possibly damaging Het
Cct2 T C 10: 117,053,113 T494A probably benign Het
Cd209e T A 8: 3,849,158 N185Y probably damaging Het
Celsr1 A G 15: 86,032,887 L295P probably damaging Het
Cyp26a1 A G 19: 37,698,051 T48A possibly damaging Het
Elovl3 A G 19: 46,133,128 S37G probably benign Het
Fbxo18 T G 2: 11,769,895 D13A possibly damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Frem3 G T 8: 80,615,826 V1583L possibly damaging Het
Gm21863 C A 12: 19,954,514 Q4K possibly damaging Het
Gm266 T C 12: 111,485,698 T25A possibly damaging Het
Gm8674 T C 13: 49,901,669 noncoding transcript Het
Greb1 T C 12: 16,702,650 H897R probably damaging Het
Hells A G 19: 38,955,030 D565G probably damaging Het
Hfm1 C T 5: 106,901,818 V426I probably damaging Het
Ints6 G A 14: 62,713,689 T297I probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kmt2b A T 7: 30,569,420 M2628K probably damaging Het
Ktn1 T G 14: 47,700,612 probably benign Het
Lyst T A 13: 13,641,222 D1230E probably benign Het
Mboat1 T C 13: 30,241,317 probably null Het
Moxd2 T C 6: 40,884,953 probably null Het
Mtmr4 T C 11: 87,605,090 M527T probably damaging Het
Myt1 T A 2: 181,825,924 N1050K probably damaging Het
Ncoa6 A T 2: 155,406,080 V1768E probably damaging Het
Nelfcd G A 2: 174,420,082 C48Y probably damaging Het
Olfr372 T A 8: 72,057,763 F28I possibly damaging Het
Olfr535 T C 7: 140,493,382 I248T probably benign Het
Opn3 G A 1: 175,663,579 A296V possibly damaging Het
Pam T C 1: 97,864,442 E418G possibly damaging Het
Prrc2c A T 1: 162,697,557 N493K probably damaging Het
Ptpn18 A G 1: 34,470,219 Q165R probably damaging Het
Ptpro C A 6: 137,386,164 probably benign Het
Ralgapa1 A G 12: 55,786,322 F132S probably damaging Het
Robo1 T C 16: 72,933,742 C244R probably damaging Het
Robo3 A C 9: 37,427,464 V316G probably damaging Het
Rsl1 T C 13: 67,182,081 S198P probably damaging Het
Rsph9 T C 17: 46,134,984 D220G probably damaging Het
Rxfp2 A C 5: 150,070,212 I580L probably benign Het
Sept7 G A 9: 25,288,236 A144T possibly damaging Het
Sfn T C 4: 133,601,292 K160E probably benign Het
Ski A G 4: 155,221,572 Y317H probably damaging Het
Slc22a22 A T 15: 57,247,540 Y430* probably null Het
Src A G 2: 157,457,110 K9R probably benign Het
Srm C T 4: 148,593,996 P255L possibly damaging Het
Stpg4 T A 17: 87,422,647 N90I probably damaging Het
Sytl2 T A 7: 90,381,861 probably benign Het
Tbpl2 T C 2: 24,094,859 K92R probably benign Het
Tmem38a T A 8: 72,581,252 N178K probably damaging Het
Tmem56 G T 3: 121,231,326 probably benign Het
Tnfaip3 T C 10: 19,008,152 D160G possibly damaging Het
Ttc37 A C 13: 76,180,103 R1423S probably damaging Het
Vegfb T A 19: 6,986,039 H119L possibly damaging Het
Vmn2r95 C T 17: 18,441,299 L436F probably damaging Het
Wdr47 T C 3: 108,623,372 C394R probably benign Het
Ythdc2 T A 18: 44,855,174 Y16* probably null Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp353-ps A G 8: 42,082,296 noncoding transcript Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAGAGCCAAGTATCCCAG -3'
(R):5'- AGGACTCTCACCTACATCTTGC -3'

Sequencing Primer
(F):5'- CCCAGAATAGAGTAAAATGCATTGAC -3'
(R):5'- GGACTCTCACCTACATCTTGCTCATC -3'
Posted On2014-08-25