Incidental Mutation 'R1995:H2-M9'
ID225711
Institutional Source Beutler Lab
Gene Symbol H2-M9
Ensembl Gene ENSMUSG00000067201
Gene Namehistocompatibility 2, M region locus 9
SynonymsM9
MMRRC Submission 040005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1995 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location36639285-36642666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36641786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 123 (Y123N)
Ref Sequence ENSEMBL: ENSMUSP00000084411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087165] [ENSMUST00000087167]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087165
AA Change: Y123N

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084409
Gene: ENSMUSG00000067201
AA Change: Y123N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 2.4e-45 PFAM
transmembrane domain 216 238 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087167
AA Change: Y123N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084411
Gene: ENSMUSG00000067201
AA Change: Y123N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 25 203 5.3e-44 PFAM
IGc1 222 293 5.73e-22 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtpbp1 T G 13: 59,531,058 K145N probably damaging Het
AY358078 T A 14: 51,826,062 D388E probably damaging Het
Btbd9 A G 17: 30,274,930 Y496H possibly damaging Het
Catsperb T A 12: 101,602,767 N899K possibly damaging Het
Ccdc129 T C 6: 55,968,709 I805T probably benign Het
Cenpl T C 1: 161,078,424 S123P probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cnbd1 G A 4: 19,055,112 P105S possibly damaging Het
Col6a1 T C 10: 76,721,956 N149D probably damaging Het
Ctnna3 T A 10: 63,820,364 V241D probably damaging Het
Dcbld2 A C 16: 58,456,332 E495D probably benign Het
Dmp1 T G 5: 104,209,913 S40A possibly damaging Het
Dpysl4 A G 7: 139,096,770 I379V probably benign Het
Eral1 C T 11: 78,074,489 G367S probably benign Het
Fah C T 7: 84,602,181 R31Q probably damaging Het
Fbn1 T A 2: 125,350,373 probably null Het
Fbxo40 T C 16: 36,969,869 D293G probably damaging Het
Gemin6 A C 17: 80,227,985 T125P probably damaging Het
Gpbar1 G A 1: 74,279,444 G282D possibly damaging Het
Gria2 G A 3: 80,802,357 L10F probably benign Het
Gucy1b1 A G 3: 82,034,853 I533T probably damaging Het
Hipk2 C A 6: 38,715,974 D868Y probably damaging Het
Jarid2 T C 13: 44,874,441 L123P probably damaging Het
Kcnb2 C A 1: 15,709,766 N287K possibly damaging Het
Kdm8 G A 7: 125,452,339 G35S probably benign Het
Kirrel G T 3: 87,095,786 A100D possibly damaging Het
Ltbp2 T G 12: 84,808,446 probably null Het
Mfsd12 C A 10: 81,357,681 H28Q probably damaging Het
Neb C T 2: 52,298,732 V837M probably damaging Het
Nkain2 A G 10: 32,402,351 I26T possibly damaging Het
Nuggc A G 14: 65,611,174 R175G probably benign Het
Olfr1122 T G 2: 87,387,831 I42R probably damaging Het
Olfr1161 T A 2: 88,025,672 S317T probably benign Het
Olfr205 A G 16: 59,329,291 S73P probably damaging Het
Olfr965 T C 9: 39,719,413 F62S probably damaging Het
Pcnt G A 10: 76,392,799 Q1511* probably null Het
Piezo2 G T 18: 63,078,781 T1311K probably damaging Het
Pik3c2a T C 7: 116,354,006 Y1218C probably damaging Het
Pik3r4 T A 9: 105,669,165 S905T probably benign Het
Pikfyve T A 1: 65,246,708 D1035E probably damaging Het
Pkn3 G C 2: 30,089,977 G744A probably damaging Het
Pms1 A G 1: 53,195,015 S781P probably benign Het
Pogz C T 3: 94,877,944 R793W probably damaging Het
Prrc2a A T 17: 35,157,429 V795D probably damaging Het
Rock1 G A 18: 10,101,026 R630* probably null Het
Scd4 T A 19: 44,334,178 I70N possibly damaging Het
Serpine2 A G 1: 79,821,442 S32P probably damaging Het
Slc9c1 A C 16: 45,554,255 T328P probably damaging Het
Spata31d1b G C 13: 59,716,380 L447F probably benign Het
Speer2 A G 16: 69,858,077 S167P probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Tbcel C A 9: 42,451,661 G29W probably damaging Het
Tmcc3 T C 10: 94,578,606 S57P possibly damaging Het
Tmem240 T A 4: 155,739,847 D125E possibly damaging Het
Ttll7 G A 3: 146,961,755 C792Y possibly damaging Het
Vmn1r177 T A 7: 23,865,687 I255F probably damaging Het
Zp2 T A 7: 120,135,165 I554F probably damaging Het
Other mutations in H2-M9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:H2-M9 APN 17 36641819 splice site probably null
IGL02133:H2-M9 APN 17 36641737 missense possibly damaging 0.95
IGL02323:H2-M9 APN 17 36640741 missense probably damaging 1.00
IGL02957:H2-M9 APN 17 36642157 missense probably benign 0.00
IGL03127:H2-M9 APN 17 36640822 missense possibly damaging 0.48
R0025:H2-M9 UTSW 17 36641755 missense probably damaging 1.00
R0026:H2-M9 UTSW 17 36641527 splice site probably benign
R0926:H2-M9 UTSW 17 36641773 missense probably damaging 0.98
R1171:H2-M9 UTSW 17 36641653 missense probably benign 0.14
R1264:H2-M9 UTSW 17 36642592 missense probably benign
R4622:H2-M9 UTSW 17 36641824 splice site probably null
R4737:H2-M9 UTSW 17 36640739 nonsense probably null
R4808:H2-M9 UTSW 17 36640792 missense probably damaging 0.99
R5176:H2-M9 UTSW 17 36641631 missense probably damaging 0.98
R6756:H2-M9 UTSW 17 36642335 missense probably damaging 1.00
R6785:H2-M9 UTSW 17 36642233 missense probably damaging 0.99
X0018:H2-M9 UTSW 17 36641722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTCAGGTATTGAAGGAGCCC -3'
(R):5'- GCAGAAAGCTCAGTCACTGACC -3'

Sequencing Primer
(F):5'- GCAGGAAAGACTTTGACGACTTTAC -3'
(R):5'- CAGTCACTGACCTGGGTTTCTG -3'
Posted On2014-08-25