Incidental Mutation 'R1996:Thsd7b'
ID225718
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 129758451 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 577 (E577*)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040311] [ENSMUST00000073527]
Predicted Effect probably null
Transcript: ENSMUST00000040311
AA Change: E577*
SMART Domains Protein: ENSMUSP00000041716
Gene: ENSMUSG00000042581
AA Change: E577*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 3e-29 BLAST
Blast:TSP1 122 177 7e-24 BLAST
TSP1 182 233 2.47e-9 SMART
Blast:TSP1 290 338 1e-20 BLAST
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 1e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 4e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1051 1.15e-4 SMART
transmembrane domain 1070 1092 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073527
AA Change: E577*
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: E577*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Meta Mutation Damage Score 0.6492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5888:Thsd7b UTSW 1 130210320 nonsense probably null
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAGTTTGGCCATGCTATCTAC -3'
(R):5'- GGATAGAACGTGACCTGGTTTG -3'

Sequencing Primer
(F):5'- CTTGGCATATCTTTCTTGACATAGAC -3'
(R):5'- ATAGAACGTGACCTGGTTTGTTTCC -3'
Posted On2014-08-25