Incidental Mutation 'R0145:Rab11fip1'
ID22572
Institutional Source Beutler Lab
Gene Symbol Rab11fip1
Ensembl Gene ENSMUSG00000031488
Gene NameRAB11 family interacting protein 1 (class I)
Synonyms4833414G05Rik, 2010200K21Rik
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0145 (G1) of strain 722
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location27138773-27174646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27143324 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1118 (L1118P)
Ref Sequence ENSEMBL: ENSMUSP00000058042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033878] [ENSMUST00000054212] [ENSMUST00000209377]
Predicted Effect probably damaging
Transcript: ENSMUST00000033878
AA Change: L597P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033878
Gene: ENSMUSG00000031488
AA Change: L597P

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
Pfam:RBD-FIP 588 635 6.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054212
AA Change: L1118P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058042
Gene: ENSMUSG00000031488
AA Change: L1118P

DomainStartEndE-ValueType
C2 19 125 1.57e-13 SMART
low complexity region 173 185 N/A INTRINSIC
low complexity region 201 227 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 373 396 N/A INTRINSIC
low complexity region 423 438 N/A INTRINSIC
low complexity region 582 600 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 745 757 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
low complexity region 976 983 N/A INTRINSIC
low complexity region 992 999 N/A INTRINSIC
Pfam:RBD-FIP 1109 1156 3.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181424
Predicted Effect probably benign
Transcript: ENSMUST00000209377
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the Rab11-family interacting proteins (Rab11-FIPs), which play a role in the Rab-11 mediated recycling of vesicles. The encoded protein may be involved in endocytic sorting, trafficking of proteins including integrin subunits and epidermal growth factor receptor (EGFR), and transport between the recycling endosome and the trans-Golgi network. Alternative splicing results in multiple transcript variants. A pseudogene is described on the X chromosome. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous knockout results in reduced metastatic potential of pancreatic adenocarcinoma (PDAC) tumor cells in KPC (PDAC model) mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tnfaip2 T A 12: 111,445,858 V231E possibly damaging Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Rab11fip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Rab11fip1 APN 8 27154776 missense possibly damaging 0.71
IGL01976:Rab11fip1 APN 8 27152797 missense possibly damaging 0.56
IGL02832:Rab11fip1 APN 8 27152812 missense possibly damaging 0.79
IGL02799:Rab11fip1 UTSW 8 27152760 missense probably benign 0.12
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0046:Rab11fip1 UTSW 8 27153121 missense probably damaging 0.99
R0243:Rab11fip1 UTSW 8 27152225 missense probably damaging 1.00
R0427:Rab11fip1 UTSW 8 27154492 missense probably damaging 0.99
R1341:Rab11fip1 UTSW 8 27143360 missense probably damaging 0.99
R1487:Rab11fip1 UTSW 8 27154212 missense probably damaging 0.99
R1509:Rab11fip1 UTSW 8 27153023 missense probably damaging 1.00
R1731:Rab11fip1 UTSW 8 27152410 missense probably damaging 0.98
R3832:Rab11fip1 UTSW 8 27152746 missense probably benign
R4157:Rab11fip1 UTSW 8 27152147 missense probably damaging 1.00
R4451:Rab11fip1 UTSW 8 27154477 missense probably damaging 1.00
R4595:Rab11fip1 UTSW 8 27154575 missense probably damaging 0.98
R4620:Rab11fip1 UTSW 8 27154215 missense probably damaging 1.00
R4753:Rab11fip1 UTSW 8 27152741 missense probably benign
R4834:Rab11fip1 UTSW 8 27153083 missense probably damaging 1.00
R4958:Rab11fip1 UTSW 8 27154813 missense probably damaging 0.99
R5102:Rab11fip1 UTSW 8 27156374 missense probably damaging 0.99
R5558:Rab11fip1 UTSW 8 27151975 missense probably damaging 1.00
R5752:Rab11fip1 UTSW 8 27156586 missense probably damaging 0.99
R5859:Rab11fip1 UTSW 8 27154720 missense probably damaging 1.00
R6525:Rab11fip1 UTSW 8 27156499 missense probably benign 0.45
R6527:Rab11fip1 UTSW 8 27174392 missense probably damaging 0.99
R6551:Rab11fip1 UTSW 8 27156484 missense probably damaging 0.96
R6695:Rab11fip1 UTSW 8 27143234 missense probably damaging 1.00
R6730:Rab11fip1 UTSW 8 27143229 missense probably damaging 1.00
R6810:Rab11fip1 UTSW 8 27152732 frame shift probably null
R6925:Rab11fip1 UTSW 8 27152972 missense probably damaging 1.00
R6941:Rab11fip1 UTSW 8 27156275 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTGTGCTAGTTACTAGGGAGACCAC -3'
(R):5'- ACCAGAGGTGTGAGAACTGTAAGCC -3'

Sequencing Primer
(F):5'- TTACTAGGGAGACCACGCCTC -3'
(R):5'- tcttctgctattgagctgcc -3'
Posted On2013-04-16