Incidental Mutation 'R1996:Traf3'
ID225775
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1996 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111260661 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 328 (K328E)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021706
AA Change: K328E

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: K328E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: K303E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: K303E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: K303E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: K303E

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610020H08Rik T A 7: 119,823,857 V304E probably damaging Het
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V274I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E877D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 noncoding transcript Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 S86P probably benign Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 noncoding transcript Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W21L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Phka2 T C X: 160,541,415 I255T probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y585C probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 noncoding transcript Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Tyw1 T A 5: 130,262,811 noncoding transcript Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 R531G unknown Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense
Hulk UTSW 12 111261576 missense probably damaging 1.00
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 nonsense probably null
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense probably benign 0.05
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGTTCCTATCCCCAGAGACTCC -3'
(R):5'- GAAAACTGCCCCTACTAGAGGC -3'

Sequencing Primer
(F):5'- TATCCCCAGAGACTCCCAGGAG -3'
(R):5'- TACTAGAGGCCTCCCAGCATG -3'
Posted OnAug 25, 2014