Incidental Mutation 'R1996:Phka2'
ID225806
Institutional Source Beutler Lab
Gene Symbol Phka2
Ensembl Gene ENSMUSG00000031295
Gene Namephosphorylase kinase alpha 2
Synonyms6330505C01Rik, Phk, k
MMRRC Submission 040006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1996 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location160502166-160598878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160541415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 255 (I255T)
Ref Sequence ENSEMBL: ENSMUSP00000107999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033652] [ENSMUST00000112376] [ENSMUST00000112377] [ENSMUST00000112380]
Predicted Effect probably benign
Transcript: ENSMUST00000033652
AA Change: I255T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033652
Gene: ENSMUSG00000031295
AA Change: I255T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112376
AA Change: I255T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107995
Gene: ENSMUSG00000031295
AA Change: I255T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 521 1.5e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112377
AA Change: I255T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107996
Gene: ENSMUSG00000031295
AA Change: I255T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112380
AA Change: I255T

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107999
Gene: ENSMUSG00000031295
AA Change: I255T

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 4.5e-197 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154142
Meta Mutation Damage Score 0.2096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,669,597 W1069R probably damaging Het
Aaas C T 15: 102,340,059 V241I probably benign Het
Abca3 A G 17: 24,387,532 E787G probably damaging Het
Abi3bp A T 16: 56,671,357 E582D possibly damaging Het
Adam21 A G 12: 81,559,602 M462T possibly damaging Het
Alox12e T C 11: 70,316,208 T591A probably benign Het
Ankmy2 T C 12: 36,193,797 M337T probably benign Het
Antxrl A G 14: 34,075,829 N587S probably benign Het
Apol6 T A 15: 77,050,756 I75N probably benign Het
Atad2b A T 12: 4,990,883 H184L probably benign Het
Atf6b A T 17: 34,652,987 probably null Het
AU022751 GTCATCATCATCATC GTCATCATCATCATCATC X: 6,082,591 probably benign Het
B3gnt4 G A 5: 123,511,339 V256I probably damaging Het
BC034090 C T 1: 155,221,594 probably benign Het
Bend4 C A 5: 67,400,184 V430F probably damaging Het
Camkv A G 9: 107,947,121 D244G probably damaging Het
Caps2 T A 10: 112,204,003 L450Q probably damaging Het
Ccr1 T A 9: 123,963,514 K326N probably benign Het
Cep135 T C 5: 76,632,266 I815T probably benign Het
Chchd4 A G 6: 91,465,134 Y101H probably damaging Het
Copb1 G C 7: 114,232,203 A570G probably benign Het
Cpsf2 C A 12: 101,998,608 T505K probably benign Het
Cwf19l2 A G 9: 3,417,947 R136G probably benign Het
Daxx A G 17: 33,913,611 T572A possibly damaging Het
Etaa1 C A 11: 17,952,671 D89Y probably damaging Het
Fchsd2 T C 7: 101,278,453 F701L probably benign Het
Fstl5 A T 3: 76,707,834 H734L probably benign Het
Gabbr1 T A 17: 37,069,220 W584R probably damaging Het
Galc T C 12: 98,252,026 D189G probably damaging Het
Gm4778 A T 3: 94,265,711 M9L probably benign Het
Gm9979 T C 13: 40,705,752 noncoding transcript Het
Grin2b T C 6: 136,044,211 S31G possibly damaging Het
Gtf2ird1 T C 5: 134,376,886 probably benign Het
Hoxc4 T C 15: 103,035,757 I187T probably damaging Het
Hsd3b6 A T 3: 98,806,281 I234N probably damaging Het
Ifit3b T C 19: 34,611,477 C18R probably damaging Het
Igdcc4 T A 9: 65,121,819 V246E probably damaging Het
Il1rap A T 16: 26,722,493 T495S probably benign Het
Kctd19 T C 8: 105,395,300 E205G probably null Het
Kif21a A T 15: 90,994,371 C235* probably null Het
Krt16 A T 11: 100,248,788 S35T unknown Het
Lamc2 T C 1: 153,154,470 D142G possibly damaging Het
Larp4 G T 15: 99,984,963 W22L probably damaging Het
Ldlrad1 C T 4: 107,214,961 R127* probably null Het
Mamdc2 G A 19: 23,363,925 Q229* probably null Het
Mbtd1 CT CTT 11: 93,932,396 probably null Het
Msln T A 17: 25,754,219 M1L possibly damaging Het
Mtch2 T C 2: 90,847,321 V8A possibly damaging Het
Nav3 A T 10: 109,853,401 N338K probably damaging Het
Olfr248 T C 1: 174,391,417 M116T probably damaging Het
Olfr33 A G 7: 102,713,792 L207P probably damaging Het
Olfr774 C A 10: 129,238,429 N93K possibly damaging Het
Otof A G 5: 30,421,037 V89A probably benign Het
Pias2 T C 18: 77,129,063 probably null Het
Pja2 T A 17: 64,287,644 probably null Het
Plxnb2 C T 15: 89,158,768 V1473I probably benign Het
Pnpt1 T A 11: 29,141,679 D363E probably benign Het
Prdm5 A G 6: 65,936,088 Y207C probably damaging Het
Rexo5 T A 7: 119,823,857 V304E probably damaging Het
Robo1 G T 16: 72,970,179 R413L probably benign Het
Rsf1 G A 7: 97,664,632 E864K probably damaging Het
Scap C T 9: 110,372,971 probably benign Het
Scn8a T A 15: 101,024,379 M1311K probably damaging Het
Slc28a2 A T 2: 122,455,562 I460F probably damaging Het
Smco1 A G 16: 32,273,912 R134G probably benign Het
Sspo A G 6: 48,475,490 E2651G possibly damaging Het
Stab2 T C 10: 87,003,031 N57S probably damaging Het
Tenm3 C A 8: 48,228,668 Q2642H probably damaging Het
Thsd7b G T 1: 129,758,451 E577* probably null Het
Tlr3 A G 8: 45,397,697 V721A probably benign Het
Tnik A G 3: 28,665,680 I1226V probably damaging Het
Traf3 A G 12: 111,260,661 K328E probably benign Het
Tyw1 T A 5: 130,262,811 probably benign Het
Vmn1r213 T G 13: 23,012,303 V352G probably benign Het
Vmn2r111 T C 17: 22,548,081 I812V probably benign Het
Vmn2r26 A G 6: 124,061,185 N573S probably damaging Het
Vmn2r45 G A 7: 8,472,025 T668I probably damaging Het
Zbtb20 T A 16: 43,610,080 V318E probably damaging Het
Zc2hc1c A G 12: 85,296,660 R524G probably benign Het
Zc3h18 C G 8: 122,407,387 probably benign Het
Zfp618 T C 4: 63,131,215 probably null Het
Other mutations in Phka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Phka2 APN X 160564213 missense possibly damaging 0.68
IGL02179:Phka2 APN X 160554380 critical splice donor site probably null
IGL03034:Phka2 APN X 160577550 nonsense probably null
R2054:Phka2 UTSW X 160554327 missense probably damaging 1.00
R2237:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2238:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2239:Phka2 UTSW X 160541412 missense probably damaging 1.00
R3622:Phka2 UTSW X 160544295 nonsense probably null
R3623:Phka2 UTSW X 160544295 nonsense probably null
R3701:Phka2 UTSW X 160533049 missense possibly damaging 0.95
R5735:Phka2 UTSW X 160559866 frame shift probably null
R5736:Phka2 UTSW X 160559866 frame shift probably null
R5737:Phka2 UTSW X 160559866 frame shift probably null
R5738:Phka2 UTSW X 160559866 frame shift probably null
R6812:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6813:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6957:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6960:Phka2 UTSW X 160533048 missense probably damaging 0.99
X0066:Phka2 UTSW X 160549272 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCCAGCAGATGTCATGTTG -3'
(R):5'- AGACTCTCTTTGGAAACACTCTG -3'

Sequencing Primer
(F):5'- CCAGCAGATGTCATGTTGTTAAGACC -3'
(R):5'- CTTTGGAAACACTCTGTGAGTC -3'
Posted On2014-08-25