Incidental Mutation 'R2001:Gm14139'
ID225898
Institutional Source Beutler Lab
Gene Symbol Gm14139
Ensembl Gene ENSMUSG00000079009
Gene Namepredicted gene 14139
Synonyms
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150181755-150193279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150192947 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 396 (M396K)
Ref Sequence ENSEMBL: ENSMUSP00000105552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109926] [ENSMUST00000109929]
Predicted Effect probably benign
Transcript: ENSMUST00000109926
AA Change: M396K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105552
Gene: ENSMUSG00000079009
AA Change: M396K

DomainStartEndE-ValueType
Blast:KRAB 1 34 7e-15 BLAST
ZnF_C2H2 71 93 8.6e-5 SMART
ZnF_C2H2 99 121 1.76e-1 SMART
ZnF_C2H2 127 149 3.02e0 SMART
ZnF_C2H2 183 205 6.08e-5 SMART
ZnF_C2H2 211 233 1.04e-3 SMART
ZnF_C2H2 239 261 2.57e-3 SMART
ZnF_C2H2 267 289 1.06e-4 SMART
ZnF_C2H2 295 317 2.2e-2 SMART
ZnF_C2H2 323 345 4.47e-3 SMART
ZnF_C2H2 351 373 7.37e-4 SMART
ZnF_C2H2 379 401 4.24e-4 SMART
ZnF_C2H2 407 429 1.2e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109929
AA Change: M427K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105555
Gene: ENSMUSG00000079009
AA Change: M427K

DomainStartEndE-ValueType
KRAB 3 65 1.65e-15 SMART
ZnF_C2H2 102 124 8.6e-5 SMART
ZnF_C2H2 130 152 1.76e-1 SMART
ZnF_C2H2 158 180 3.02e0 SMART
ZnF_C2H2 214 236 6.08e-5 SMART
ZnF_C2H2 242 264 1.04e-3 SMART
ZnF_C2H2 270 292 2.57e-3 SMART
ZnF_C2H2 298 320 1.06e-4 SMART
ZnF_C2H2 326 348 2.2e-2 SMART
ZnF_C2H2 354 376 4.47e-3 SMART
ZnF_C2H2 382 404 7.37e-4 SMART
ZnF_C2H2 410 432 4.24e-4 SMART
ZnF_C2H2 438 460 1.2e-3 SMART
ZnF_C2H2 466 488 2.61e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Gm14139
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0254:Gm14139 UTSW 2 150191864 missense possibly damaging 0.78
R0505:Gm14139 UTSW 2 150193080 nonsense probably null
R0562:Gm14139 UTSW 2 150192574 missense probably damaging 1.00
R1239:Gm14139 UTSW 2 150191971 missense possibly damaging 0.94
R1878:Gm14139 UTSW 2 150193069 missense probably damaging 1.00
R1966:Gm14139 UTSW 2 150191907 missense probably benign 0.00
R2208:Gm14139 UTSW 2 150193145 missense probably benign 0.40
R3110:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R3112:Gm14139 UTSW 2 150192221 missense probably damaging 1.00
R4135:Gm14139 UTSW 2 150181868 splice site probably benign
R4299:Gm14139 UTSW 2 150190733 missense probably damaging 1.00
R4579:Gm14139 UTSW 2 150192223 missense probably damaging 1.00
R4818:Gm14139 UTSW 2 150192061 missense probably damaging 1.00
R4894:Gm14139 UTSW 2 150191979 nonsense probably null
R5432:Gm14139 UTSW 2 150191981 missense possibly damaging 0.68
R5669:Gm14139 UTSW 2 150192178 missense probably benign 0.09
R6106:Gm14139 UTSW 2 150192805 missense probably damaging 1.00
R6857:Gm14139 UTSW 2 150192062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGTCCCAATTCTCTTCAATAC -3'
(R):5'- GTATGTGTTCTAATATGCACTCGGAG -3'

Sequencing Primer
(F):5'- ACAATGTGGTAAAGCCTTTGC -3'
(R):5'- GCACTCGGAGATTATTAGAATATGC -3'
Posted On2014-08-25