Incidental Mutation 'R2001:Agtpbp1'
List |< first << previous [record 65 of 1259] next >> last >|
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 040011-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R2001 (G1)
Quality Score217
Status Not validated
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TGAAGATGCATCTTGAGAAGA to TGAAGA at 59475803 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]
Predicted Effect probably null
Transcript: ENSMUST00000022040
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557

low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163149
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164215
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557

low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably null
Transcript: ENSMUST00000168141
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000170555
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224397
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site
gru UTSW 13 59473746 missense not run
rio UTSW 13 59525241 critical splice acceptor site
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25