Incidental Mutation 'R2001:Ankrd28'
ID225970
Institutional Source Beutler Lab
Gene Symbol Ankrd28
Ensembl Gene ENSMUSG00000014496
Gene Nameankyrin repeat domain 28
SynonymsE430019N21Rik
MMRRC Submission 040011-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R2001 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31698768-31830651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31745336 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 39 (V39E)
Ref Sequence ENSEMBL: ENSMUSP00000154197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014640] [ENSMUST00000227089] [ENSMUST00000227863] [ENSMUST00000227878] [ENSMUST00000228037]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014640
AA Change: V193E

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014640
Gene: ENSMUSG00000014496
AA Change: V193E

DomainStartEndE-ValueType
ANK 7 36 5.69e2 SMART
ANK 40 69 2.45e-4 SMART
ANK 73 102 1.59e-3 SMART
ANK 106 135 1.09e-1 SMART
ANK 139 168 1.58e-7 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.01e-5 SMART
ANK 238 267 2.74e-7 SMART
ANK 271 301 4.13e-2 SMART
ANK 305 334 3.8e-1 SMART
ANK 338 367 3.06e-5 SMART
ANK 371 400 1.44e-1 SMART
ANK 404 433 6.76e-7 SMART
ANK 437 466 1.73e-4 SMART
ANK 470 500 7.83e-3 SMART
ANK 504 534 2.99e1 SMART
ANK 549 578 1.34e-1 SMART
ANK 582 611 3.76e-5 SMART
ANK 616 645 4.13e-2 SMART
ANK 652 681 1.24e-5 SMART
ANK 685 714 4.5e-3 SMART
ANK 718 747 1.93e-2 SMART
ANK 755 784 2.85e-5 SMART
ANK 787 818 2.15e0 SMART
ANK 822 851 2.16e-5 SMART
ANK 855 885 4.5e-3 SMART
ANK 889 918 6.61e-1 SMART
ANK 925 954 3.85e-2 SMART
low complexity region 982 995 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227083
Predicted Effect possibly damaging
Transcript: ENSMUST00000227089
AA Change: V39E

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227307
Predicted Effect possibly damaging
Transcript: ENSMUST00000227863
AA Change: V223E

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000227878
Predicted Effect possibly damaging
Transcript: ENSMUST00000228037
AA Change: V165E

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Adamts20 T C 15: 94,347,718 T568A possibly damaging Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Ankrd28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Ankrd28 APN 14 31743365 missense possibly damaging 0.94
IGL01335:Ankrd28 APN 14 31702024 missense probably damaging 0.99
IGL01564:Ankrd28 APN 14 31755767 missense probably damaging 1.00
IGL01624:Ankrd28 APN 14 31710857 missense probably benign 0.00
IGL01987:Ankrd28 APN 14 31778974 missense probably damaging 1.00
IGL02100:Ankrd28 APN 14 31727625 unclassified probably benign
IGL02307:Ankrd28 APN 14 31733708 missense probably damaging 1.00
IGL02656:Ankrd28 APN 14 31702240 missense possibly damaging 0.94
IGL03069:Ankrd28 APN 14 31755786 nonsense probably null
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0038:Ankrd28 UTSW 14 31708035 missense probably damaging 0.99
R0124:Ankrd28 UTSW 14 31727741 missense probably damaging 1.00
R0347:Ankrd28 UTSW 14 31702022 makesense probably null
R0452:Ankrd28 UTSW 14 31748738 missense probably damaging 1.00
R0685:Ankrd28 UTSW 14 31743450 unclassified probably benign
R0751:Ankrd28 UTSW 14 31764268 missense probably damaging 1.00
R1349:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1372:Ankrd28 UTSW 14 31745261 missense probably benign 0.05
R1695:Ankrd28 UTSW 14 31707244 missense probably damaging 1.00
R1888:Ankrd28 UTSW 14 31732025 splice site probably benign
R1938:Ankrd28 UTSW 14 31705276 missense possibly damaging 0.74
R2162:Ankrd28 UTSW 14 31708762 missense probably damaging 1.00
R2352:Ankrd28 UTSW 14 31710947 missense probably benign 0.05
R2357:Ankrd28 UTSW 14 31764294 nonsense probably null
R3545:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3548:Ankrd28 UTSW 14 31715260 missense probably benign 0.13
R3710:Ankrd28 UTSW 14 31748851 splice site probably benign
R4282:Ankrd28 UTSW 14 31745225 missense possibly damaging 0.74
R4501:Ankrd28 UTSW 14 31706796 missense probably damaging 0.97
R4513:Ankrd28 UTSW 14 31743285 missense probably damaging 1.00
R4658:Ankrd28 UTSW 14 31710868 missense probably damaging 1.00
R4731:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4732:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4733:Ankrd28 UTSW 14 31755741 missense probably benign 0.43
R4776:Ankrd28 UTSW 14 31732054 missense probably damaging 1.00
R4801:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R4802:Ankrd28 UTSW 14 31736830 missense probably damaging 1.00
R5279:Ankrd28 UTSW 14 31735006 missense probably damaging 0.99
R5633:Ankrd28 UTSW 14 31735065 missense probably damaging 1.00
R5809:Ankrd28 UTSW 14 31743354 missense probably benign 0.19
R5959:Ankrd28 UTSW 14 31729922 missense probably benign 0.16
R6228:Ankrd28 UTSW 14 31707220 missense probably damaging 1.00
R6358:Ankrd28 UTSW 14 31710864 missense probably damaging 1.00
R6533:Ankrd28 UTSW 14 31732084 missense possibly damaging 0.49
R6598:Ankrd28 UTSW 14 31708939 missense probably damaging 1.00
R6822:Ankrd28 UTSW 14 31736840 critical splice acceptor site probably null
R7352:Ankrd28 UTSW 14 31708041 missense probably damaging 1.00
R7396:Ankrd28 UTSW 14 31702202 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTATACTAGCTAGTGAAGAGTTAG -3'
(R):5'- TCATGCCATGACCTGACAGAG -3'

Sequencing Primer
(F):5'- GCTAGTGAAGAGTTAGAAAGACTTG -3'
(R):5'- GAACAAGATCTAGTCAAGGTTAACAC -3'
Posted On2014-08-25