Incidental Mutation 'R2001:Adamts20'
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20
SynonymsADAMTS-20, bt
MMRRC Submission 040011-MU
Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R2001 (G1)
Quality Score212
Status Not validated
Chromosomal Location94270163-94465418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94347718 bp
Amino Acid Change Threonine to Alanine at position 568 (T568A)
Ref Sequence ENSEMBL: ENSMUSP00000121696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035342
AA Change: T568A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: T568A

signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129195
Predicted Effect possibly damaging
Transcript: ENSMUST00000155907
AA Change: T568A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: T568A

signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 1e-31 PFAM
Pfam:Reprolysin_5 253 445 2.7e-13 PFAM
Pfam:Reprolysin_4 253 460 7.2e-8 PFAM
Pfam:Reprolysin 255 464 2.4e-28 PFAM
Pfam:Reprolysin_2 272 454 4e-10 PFAM
Pfam:Reprolysin_3 276 410 1.1e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,741,456 S559P probably benign Het
A430005L14Rik T A 4: 153,959,857 C42S probably damaging Het
Abca13 A T 11: 9,273,967 T449S probably benign Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamts13 C T 2: 26,973,990 P60L probably benign Het
Ago1 T C 4: 126,454,394 I44V probably null Het
Agtpbp1 TGAAGATGCATCTTGAGAAGA TGAAGA 13: 59,475,803 probably null Het
Ankrd28 A T 14: 31,745,336 V39E possibly damaging Het
Apaf1 A G 10: 91,061,814 V269A possibly damaging Het
Asna1 T C 8: 85,025,160 S36G probably damaging Het
Astn1 A G 1: 158,520,521 N506D probably damaging Het
BC051019 G A 7: 109,720,551 Q102* probably null Het
Bpifb5 A G 2: 154,233,279 T376A possibly damaging Het
Ccdc121 G T 1: 181,510,986 Q134K probably benign Het
Ccl20 ATT ATTT 1: 83,117,855 probably null Het
Ccl6 G T 11: 83,589,337 P68T possibly damaging Het
Cd300ld A T 11: 114,987,330 F119I probably benign Het
Cdk2ap2 A G 19: 4,097,903 M57V possibly damaging Het
Chkb C T 15: 89,428,766 G36E probably damaging Het
Col11a1 A G 3: 114,165,293 probably null Het
Ctla2b T C 13: 60,896,067 Y120C probably damaging Het
Ctnnd1 T C 2: 84,620,360 N172S probably benign Het
Cyp2a22 G A 7: 26,934,772 P319L probably damaging Het
Dcaf12 A C 4: 41,302,804 V117G probably damaging Het
Ddx6 A G 9: 44,607,534 T48A probably benign Het
Dgki T C 6: 36,865,801 D923G possibly damaging Het
Dhx37 G T 5: 125,427,464 T345K probably damaging Het
Dhx9 A T 1: 153,456,111 Y1370* probably null Het
Dnah7b T C 1: 46,142,087 S1045P possibly damaging Het
Dnmbp G C 19: 43,850,173 T1071S possibly damaging Het
Dspp T A 5: 104,178,559 S929R unknown Het
Dst A T 1: 34,184,063 E1625D probably damaging Het
Egflam T A 15: 7,242,567 H630L probably benign Het
Elane T C 10: 79,887,759 V186A possibly damaging Het
Fam209 C A 2: 172,472,769 N59K probably benign Het
Gbe1 A G 16: 70,528,926 E617G probably damaging Het
Gfra1 A G 19: 58,300,275 L246P probably damaging Het
Gm14139 T A 2: 150,192,947 M396K probably benign Het
Gria2 T C 3: 80,710,805 T308A probably benign Het
Grip2 A T 6: 91,779,850 V540D probably benign Het
Hhipl1 A T 12: 108,321,859 I575F possibly damaging Het
Hmcn1 T A 1: 150,738,613 E1347D possibly damaging Het
Itga2b C A 11: 102,467,339 A187S probably benign Het
Kalrn C A 16: 34,028,045 R469M probably damaging Het
Kif23 A T 9: 61,927,384 C426* probably null Het
Lck T C 4: 129,548,937 N475S probably benign Het
Leng8 A G 7: 4,145,074 N642S probably damaging Het
Lingo4 T A 3: 94,403,075 I440N probably damaging Het
Lrrc4 A G 6: 28,830,905 F237S probably damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Naip2 A T 13: 100,144,588 I1316N probably damaging Het
Naip6 C T 13: 100,300,729 G429S probably benign Het
Noct C T 3: 51,248,044 R78C probably damaging Het
Npbwr1 A G 1: 5,917,175 V40A possibly damaging Het
Nsd2 A G 5: 33,843,402 N88D probably damaging Het
Olfr1020 T A 2: 85,850,400 V316E probably benign Het
Olfr1066 T C 2: 86,455,473 H266R probably benign Het
Olfr389 T A 11: 73,776,713 I205F probably benign Het
Olfr800 T A 10: 129,660,421 I205N probably benign Het
Pak7 T A 2: 136,116,637 H177L probably benign Het
Pard3 C T 8: 127,064,347 probably null Het
Pde4c A G 8: 70,747,358 probably null Het
Pde6h T A 6: 136,963,205 I63N probably damaging Het
Phldb2 T C 16: 45,774,195 K916E possibly damaging Het
Ppig T C 2: 69,741,644 S236P unknown Het
Ptprd T C 4: 75,954,122 Y1370C probably damaging Het
Pzp T C 6: 128,516,120 T352A probably benign Het
Rab3gap1 A G 1: 127,903,719 Y177C possibly damaging Het
Rasgef1a G A 6: 118,089,196 V457M probably benign Het
Scel A T 14: 103,610,790 T616S possibly damaging Het
Sel1l A T 12: 91,826,550 Y228* probably null Het
Sgms1 A G 19: 32,159,683 V161A possibly damaging Het
Slfnl1 T C 4: 120,533,227 L25P probably benign Het
Smad5 A G 13: 56,737,374 T432A probably damaging Het
Sohlh2 T C 3: 55,192,341 probably null Het
Sphkap A T 1: 83,276,662 M835K probably damaging Het
Sqor A C 2: 122,798,098 T174P probably damaging Het
Stkld1 T C 2: 26,952,747 V577A probably damaging Het
Sulf2 T A 2: 166,080,853 E652D probably benign Het
Sycp2 T A 2: 178,378,055 Q556L probably benign Het
Syk A G 13: 52,611,238 T134A probably benign Het
Tas2r122 T A 6: 132,711,622 I103F possibly damaging Het
Tex10 A G 4: 48,451,940 W729R probably damaging Het
Tex261 G T 6: 83,773,731 P95T probably damaging Het
Tm2d2 T C 8: 25,017,507 S47P probably benign Het
Tmem2 A G 19: 21,801,987 D387G probably benign Het
Tmem95 A G 11: 69,876,991 S128P probably damaging Het
Tnxb G A 17: 34,692,579 A1619T possibly damaging Het
Trappc9 A G 15: 73,058,036 I157T probably damaging Het
Unc13c T A 9: 73,483,615 probably null Het
Upb1 A T 10: 75,429,969 Y210F probably damaging Het
Urb1 T C 16: 90,762,344 M1684V probably benign Het
Wnk2 G A 13: 49,078,682 P727S possibly damaging Het
Zfp551 A T 7: 12,416,349 S378T probably damaging Het
Zfp598 T C 17: 24,669,924 V56A possibly damaging Het
Zfp945 C T 17: 22,857,249 probably null Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94394641 missense probably benign
IGL00491:Adamts20 APN 15 94273232 missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94403397 missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94341105 missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94282482 missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94379813 missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94344042 missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94394611 critical splice donor site probably null
IGL01457:Adamts20 APN 15 94331448 missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94403446 missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94326106 missense probably benign 0.08
IGL02525:Adamts20 APN 15 94283078 splice site probably null
IGL03088:Adamts20 APN 15 94329914 critical splice donor site probably null
IGL03175:Adamts20 APN 15 94273255 nonsense probably null
belt UTSW 15 94345990 missense probably damaging 1.00
buckeye UTSW 15 94341087 missense probably damaging 1.00
jack_white UTSW 15 unclassified
Meowth UTSW 15 94331458 missense probably damaging 1.00
nidoking UTSW 15 94403445 missense probably damaging 1.00
panda UTSW 15 94326699 nonsense
pikachu UTSW 15 94345990 missense probably damaging 1.00
poliwag UTSW 15 94394622 nonsense probably null
splotch2 UTSW 15 94335561 splice acceptor site
wash UTSW 15 94347670 nonsense probably null
whitebelly UTSW 15 unclassified
whopper UTSW 15 94347810 missense
R0483:Adamts20 UTSW 15 94353571 missense probably benign 0.00
R0514:Adamts20 UTSW 15 94270376 missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94291713 splice site probably benign
R0730:Adamts20 UTSW 15 94347690 missense probably benign 0.00
R0973:Adamts20 UTSW 15 94286371 missense probably benign 0.00
R1339:Adamts20 UTSW 15 94322896 missense probably benign 0.19
R1721:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1809:Adamts20 UTSW 15 94341087 missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94286344 missense probably benign 0.00
R1846:Adamts20 UTSW 15 94345990 missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94338459 missense probably benign 0.44
R1875:Adamts20 UTSW 15 94331396 missense probably benign 0.01
R1930:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1931:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R1932:Adamts20 UTSW 15 94404010 missense probably benign 0.03
R2116:Adamts20 UTSW 15 94355362 missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94283916 missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2889:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R2890:Adamts20 UTSW 15 94330578 missense probably benign 0.00
R3109:Adamts20 UTSW 15 94345904 splice site probably benign
R3719:Adamts20 UTSW 15 94361838 missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94331458 missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94328845 missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94333695 missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94379946 missense probably benign
R4431:Adamts20 UTSW 15 94344043 missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94403445 missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94345920 missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94379750 missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94403325 missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94394622 nonsense probably null
R4707:Adamts20 UTSW 15 94333647 missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94351762 missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94351635 splice site probably null
R4829:Adamts20 UTSW 15 94326396 missense probably benign 0.01
R4937:Adamts20 UTSW 15 94379775 missense probably benign
R4960:Adamts20 UTSW 15 94379774 missense probably benign
R5270:Adamts20 UTSW 15 94282519 missense probably benign 0.00
R5388:Adamts20 UTSW 15 94345778 missense possibly damaging 0.81
R5410:Adamts20 UTSW 15 94281957 missense possibly damaging 0.94
R5453:Adamts20 UTSW 15 94326088 missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94273280 missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94325971 missense probably benign 0.36
R5758:Adamts20 UTSW 15 94394650 missense probably benign 0.00
R5801:Adamts20 UTSW 15 94347670 nonsense probably null
R5834:Adamts20 UTSW 15 94353584 missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94338723 missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94379747 missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94282483 missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94330047 nonsense probably null
R6217:Adamts20 UTSW 15 94338715 missense probably benign 0.00
R6283:Adamts20 UTSW 15 94351721 missense probably benign
R6354:Adamts20 UTSW 15 94347810 missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94324659 critical splice donor site probably null
R6419:Adamts20 UTSW 15 94333675 missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94361810 missense probably benign 0.22
R6485:Adamts20 UTSW 15 94343971 missense probably benign 0.17
R6517:Adamts20 UTSW 15 94283104 intron probably null
R6675:Adamts20 UTSW 15 94331316 critical splice donor site probably null
R6863:Adamts20 UTSW 15 94379746 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-08-25