Mutagenetix > Incidental Mutation

Incidental Mutation 'R1004:Mroh2a'

226023

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804

MMRRC Submission

039114-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R1004 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88154713-88190011 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 88170142 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 685 (A685D)

Ref Sequence

ENSEMBL: ENSMUSP00000108755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061013
AA Change: A688D

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: A688D

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113130
AA Change: A685D

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: A685D

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142632

Meta Mutation Damage Score

0.2131

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,042,780 (GRCm39)	I423T	possibly damaging	Het
Agbl3	A	T	6: 34,780,386 (GRCm39)	E453V	probably damaging	Het
Agxt	A	G	1: 93,063,421 (GRCm39)	M108V	possibly damaging	Het
Akap13	T	C	7: 75,337,034 (GRCm39)	I831T	probably damaging	Het
Anpep	C	T	7: 79,488,004 (GRCm39)	E518K	probably benign	Het
Arid1a	A	G	4: 133,414,586 (GRCm39)	M1215T	unknown	Het
Cd163	G	T	6: 124,302,306 (GRCm39)	D957Y	probably damaging	Het
Ces2e	A	G	8: 105,656,370 (GRCm39)	D200G	probably damaging	Het
Cfap54	T	C	10: 92,902,558 (GRCm39)		probably benign	Het
Col11a1	A	G	3: 113,888,671 (GRCm39)		probably benign	Het
Dlx6	C	T	6: 6,863,665 (GRCm39)	Q96*	probably null	Het
Dpp4	T	A	2: 62,162,984 (GRCm39)	Q754L	probably benign	Het
Ece1	A	G	4: 137,653,550 (GRCm39)	T100A	probably benign	Het
Gabbr2	C	T	4: 46,677,544 (GRCm39)	V779M	possibly damaging	Het
Gatm	C	T	2: 122,440,141 (GRCm39)		probably benign	Het
Gpc2	A	G	5: 138,276,487 (GRCm39)	L213P	probably damaging	Het
Hook1	A	C	4: 95,910,524 (GRCm39)	N713H	probably benign	Het
Kdm5b	T	A	1: 134,516,642 (GRCm39)	I178K	possibly damaging	Het
Mettl9	G	A	7: 120,675,460 (GRCm39)	V287I	probably benign	Het
Mycbp2	G	A	14: 103,378,353 (GRCm39)	T3774I	probably benign	Het
Nup58	C	A	14: 60,484,930 (GRCm39)		probably benign	Het
Nxf1	A	T	19: 8,741,681 (GRCm39)	T119S	probably benign	Het
Oaz3	T	A	3: 94,342,350 (GRCm39)	H102L	probably damaging	Het
Or8g2b	T	C	9: 39,751,276 (GRCm39)	F182S	probably benign	Het
Pfpl	A	T	19: 12,407,789 (GRCm39)	Q680L	probably benign	Het
Poli	T	A	18: 70,658,509 (GRCm39)	Q75L	probably benign	Het
Ppp2r3d	C	T	9: 101,075,829 (GRCm39)		probably null	Het
Prr30	A	G	14: 101,436,529 (GRCm39)	L11P	probably damaging	Het
Ptchd4	A	T	17: 42,688,493 (GRCm39)	Y345F	probably benign	Het
Ric1	A	G	19: 29,579,757 (GRCm39)	N1233S	probably benign	Het
Serpinb9f	TA	"TTTNA,T"	13: 33,518,225 (GRCm39)		probably benign	Het
Sh3bgrl2	C	T	9: 83,459,684 (GRCm39)		probably benign	Het
Skp1	G	C	11: 52,128,207 (GRCm39)		probably benign	Het
Slc12a9	T	C	5: 137,320,786 (GRCm39)	K528R	probably damaging	Het
Slc22a6	A	G	19: 8,595,763 (GRCm39)	N35S	probably damaging	Het
Tcstv2c	T	A	13: 120,616,558 (GRCm39)	D132E	probably benign	Het
Xrcc5	A	G	1: 72,422,937 (GRCm39)		probably benign	Het
Zfp235	T	A	7: 23,840,169 (GRCm39)	L266Q	probably damaging	Het
Zfp600	T	A	4: 146,133,103 (GRCm39)		probably benign	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,172,692 (GRCm39)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,161,842 (GRCm39)	missense	possibly damaging	0.76
IGL00990:Mroh2a	APN	1	88,158,468 (GRCm39)	missense	probably damaging	0.99
IGL03097:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,156,102 (GRCm39)	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1281:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
R1414:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,169,353 (GRCm39)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,160,075 (GRCm39)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1686:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,165,213 (GRCm39)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2870:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,172,717 (GRCm39)	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3937:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,187,311 (GRCm39)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,179,087 (GRCm39)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,165,666 (GRCm39)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,169,337 (GRCm39)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,176,377 (GRCm39)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,158,390 (GRCm39)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,171,805 (GRCm39)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,179,096 (GRCm39)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,170,207 (GRCm39)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,154,813 (GRCm39)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,176,335 (GRCm39)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,160,014 (GRCm39)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,377 (GRCm39)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACTCCCAGGTTTGTGGGTAGGAAC -3'
(R):5'- AAAGCACAGGATGACGCCCTTCAG -3'

Sequencing Primer
(F):5'- TAGGAAAGGATTTGGCCTTCAC -3'
(R):5'- ACGCCCTTCAGGGAAGC -3'

Posted On

2014-09-08