Incidental Mutation 'R2010:Itpr2'
List |< first << previous [record 97 of 217] next >> last >|
ID226057
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
MMRRC Submission 040019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2010 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) G to A at 146227524 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
Predicted Effect probably null
Transcript: ENSMUST00000053273
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079573
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204901
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,481,806 G74S unknown Het
4930452B06Rik A T 14: 8,511,021 F464L probably damaging Het
4932438A13Rik T G 3: 36,928,551 N788K probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Arhgef6 T C X: 57,299,505 T52A possibly damaging Het
Aste1 C A 9: 105,403,502 H25Q probably damaging Het
Atp13a1 G A 8: 69,791,360 G36R possibly damaging Het
Bahcc1 T C 11: 120,272,778 V634A probably damaging Het
C1s1 A T 6: 124,537,394 Y168N probably damaging Het
Camsap2 T C 1: 136,274,868 S612G probably damaging Het
Cdh23 C A 10: 60,314,227 R2611L probably damaging Het
Cilp2 A G 8: 69,881,694 Y885H probably damaging Het
D430042O09Rik A G 7: 125,872,956 I1544M possibly damaging Het
Dhrs3 C T 4: 144,927,188 T227I possibly damaging Het
Dnah2 A T 11: 69,458,358 probably null Het
Dnah3 T G 7: 120,095,177 M1L probably benign Het
Ehbp1l1 A G 19: 5,719,283 I664T probably benign Het
Eif4e C T 3: 138,555,458 T171I probably benign Het
Elfn1 C T 5: 139,973,316 R692W probably damaging Het
Eps8l3 T A 3: 107,879,372 M1K probably null Het
Evi5 C A 5: 107,813,545 probably null Het
Fancd2 A T 6: 113,593,291 D1401V probably damaging Het
Fat2 G A 11: 55,253,827 R4074C probably damaging Het
Fkbp4 A T 6: 128,435,802 V55E probably benign Het
Fnip1 A G 11: 54,482,503 D180G probably damaging Het
Galc A G 12: 98,254,230 F126S possibly damaging Het
Gdf7 C T 12: 8,301,729 V69M unknown Het
Glis2 A G 16: 4,608,711 E22G probably damaging Het
Hist1h2bb G A 13: 23,747,128 V112M possibly damaging Het
Hps4 T A 5: 112,369,476 V243E probably damaging Het
Ighe T A 12: 113,271,488 I351F unknown Het
Irak4 A T 15: 94,551,806 R55S probably damaging Het
Kirrel3 T C 9: 34,939,198 Y41H probably damaging Het
Krr1 A G 10: 111,975,569 E56G possibly damaging Het
Lgi1 G A 19: 38,301,235 V250I probably damaging Het
Lipf A G 19: 33,973,546 N306D probably benign Het
Lman2l C T 1: 36,445,181 W18* probably null Het
Lztfl1 T A 9: 123,702,186 N239I possibly damaging Het
Mief1 T C 15: 80,247,925 S66P possibly damaging Het
Mmp8 C A 9: 7,567,534 S465* probably null Het
Muc2 A T 7: 141,700,875 T208S probably damaging Het
Myh8 A T 11: 67,297,164 K921* probably null Het
Myh9 T C 15: 77,771,947 E1121G probably benign Het
Nbn T C 4: 15,969,393 S213P probably damaging Het
Nol10 A G 12: 17,416,101 E499G probably benign Het
Nxn T C 11: 76,398,801 E87G probably damaging Het
Olfr293 A G 7: 86,664,603 T314A probably benign Het
Olfr568 T A 7: 102,877,685 C188* probably null Het
Olfr937 T C 9: 39,060,099 H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Pigk A G 3: 152,766,514 I354M probably damaging Het
Pigl T A 11: 62,458,682 C75S probably damaging Het
Pm20d1 T A 1: 131,812,114 I400N probably benign Het
Prkg2 T A 5: 99,024,805 H17L probably benign Het
Psmd1 T A 1: 86,075,997 L168Q probably damaging Het
Rab3gap2 A T 1: 185,278,281 H1136L possibly damaging Het
Rb1 T C 14: 73,294,993 T134A probably benign Het
Rims1 T C 1: 22,296,996 E1024G probably damaging Het
Rrp12 A G 19: 41,872,937 V977A probably benign Het
Rusc2 C T 4: 43,415,212 P173S probably benign Het
Selenov A T 7: 28,288,022 D310E probably damaging Het
Serpina3f T A 12: 104,217,323 L148Q probably damaging Het
Slc10a1 C T 12: 80,960,447 V187I probably benign Het
Spsb2 A G 6: 124,810,376 K258E probably damaging Het
Tas2r105 A C 6: 131,687,402 V21G probably benign Het
Tmem229b-ps T A 10: 53,475,199 noncoding transcript Het
Tnrc6a C G 7: 123,171,046 H686Q probably benign Het
Trpc2 T A 7: 102,094,573 F715L probably benign Het
Ube2t T A 1: 134,969,298 I56N probably benign Het
Ubr4 T C 4: 139,480,652 Y4915H possibly damaging Het
Usp32 T A 11: 85,040,004 E533D probably damaging Het
Vipr2 T G 12: 116,122,810 probably null Het
Vmn1r15 A G 6: 57,258,284 T46A probably benign Het
Vmn1r203 T G 13: 22,524,447 S133A possibly damaging Het
Vmn1r215 T G 13: 23,076,208 N139K probably damaging Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Wdr20rt C A 12: 65,227,214 H311N possibly damaging Het
Zranb1 T C 7: 132,966,696 probably null Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6560:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCTTGTAAGTTCACTCC -3'
(R):5'- CGGAGACATTTACCAATACCAGTC -3'

Sequencing Primer
(F):5'- GGCCTTGTAAGTTCACTCCTCTTTC -3'
(R):5'- ATCTCCAACATTGTTTGTACACAG -3'
Posted On2014-09-11