Incidental Mutation 'R1023:Yy1'
ID226119
Institutional Source Beutler Lab
Gene Symbol Yy1
Ensembl Gene ENSMUSG00000021264
Gene NameYY1 transcription factor
SynonymsNF-E1, UCRBP transcription factor, Yin Yang 1, delta transcription factor
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1023 (G1)
Quality Score65
Status Validated
Chromosome12
Chromosomal Location108792973-108820148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108793531 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 40 (V40E)
Ref Sequence ENSEMBL: ENSMUSP00000021692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021692]
Predicted Effect unknown
Transcript: ENSMUST00000021692
AA Change: V40E
SMART Domains Protein: ENSMUSP00000021692
Gene: ENSMUSG00000021264
AA Change: V40E

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 42 82 N/A INTRINSIC
low complexity region 156 204 N/A INTRINSIC
PDB:4C5I|C 205 228 8e-9 PDB
low complexity region 257 273 N/A INTRINSIC
ZnF_C2H2 296 320 1.03e-2 SMART
ZnF_C2H2 325 347 2.2e-2 SMART
ZnF_C2H2 353 377 9.08e-4 SMART
ZnF_C2H2 383 407 9.88e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223001
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein is involved in repressing and activating a diverse number of promoters. YY1 may direct histone deacetylases and histone acetyltransferases to a promoter in order to activate or repress the promoter, thus implicating histone modification in the function of YY1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die in utero shortly after implantation. Incomplete penetrance of embryonic growth retardation and exencephaly are observed in haploinsufficient mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Yy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Yy1 APN 12 108815537 missense probably damaging 1.00
IGL02158:Yy1 APN 12 108814599 splice site probably benign
IGL02223:Yy1 APN 12 108793540 missense unknown
IGL02412:Yy1 APN 12 108794097 splice site probably benign
IGL02718:Yy1 APN 12 108815479 missense probably damaging 1.00
R1341:Yy1 UTSW 12 108793519 missense unknown
R1855:Yy1 UTSW 12 108793990 small insertion probably benign
R1989:Yy1 UTSW 12 108806608 missense probably damaging 1.00
R2022:Yy1 UTSW 12 108793990 small insertion probably benign
R4566:Yy1 UTSW 12 108812963 missense probably damaging 0.98
R4717:Yy1 UTSW 12 108794046 missense possibly damaging 0.50
R5041:Yy1 UTSW 12 108793631 small insertion probably benign
R5089:Yy1 UTSW 12 108793737 missense probably damaging 1.00
R5597:Yy1 UTSW 12 108815510 missense probably damaging 1.00
R5907:Yy1 UTSW 12 108806428 intron probably benign
R6876:Yy1 UTSW 12 108806592 missense probably benign 0.13
R6878:Yy1 UTSW 12 108814756 missense probably damaging 1.00
R6923:Yy1 UTSW 12 108793668 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CGAGCCGGAGCAGAGTGTG -3'
(R):5'- GTCGGGTCGTCCGTCACCA -3'

Sequencing Primer
(F):5'- CAGGGGGCAGCGTAACG -3'
(R):5'- TCACCAGCGGCTGCAGCGCGATCAT -3'
Posted On2014-09-12