Incidental Mutation 'R0656:Gcn1l1'
ID226139
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R0656 (G1)
Quality Score79
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115589303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 714 (T714M)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: T714M

PolyPhen 2 Score 0.269 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: T714M

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129424
Meta Mutation Damage Score 0.0472 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Timm21 T C 18: 84,949,201 H150R probably damaging Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0569:Gcn1l1 UTSW 5 115595059 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGGAAGCTCTGTGTGTCATC -3'
(R):5'- TCTATGCCCCGAGCAGTACTCATC -3'

Sequencing Primer
(F):5'- CTGGCTCAGGAGATGCTAATC -3'
(R):5'- GAGCAGTACTCATCTGTCTCTG -3'
Posted On2014-09-17