Incidental Mutation 'R0656:Timm21'
ID226159
Institutional Source Beutler Lab
Gene Symbol Timm21
Ensembl Gene ENSMUSG00000024645
Gene Nametranslocase of inner mitochondrial membrane 21
Synonyms
MMRRC Submission 038841-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0656 (G1)
Quality Score56
Status Validated
Chromosome18
Chromosomal Location84947294-84951524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84949201 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 150 (H150R)
Ref Sequence ENSEMBL: ENSMUSP00000025547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025547] [ENSMUST00000037718] [ENSMUST00000224467] [ENSMUST00000225445]
Predicted Effect probably damaging
Transcript: ENSMUST00000025547
AA Change: H150R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025547
Gene: ENSMUSG00000024645
AA Change: H150R

DomainStartEndE-ValueType
Pfam:TIM21 98 240 6.8e-51 PFAM
Pfam:Coa1 108 236 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037718
SMART Domains Protein: ENSMUSP00000045925
Gene: ENSMUSG00000034391

DomainStartEndE-ValueType
low complexity region 35 42 N/A INTRINSIC
FBOX 46 86 3.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223789
Predicted Effect probably benign
Transcript: ENSMUST00000224467
Predicted Effect probably benign
Transcript: ENSMUST00000225445
Meta Mutation Damage Score 0.498 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.2%
Validation Efficiency 98% (92/94)
MGI Phenotype Both male and female homozygous null mice develop normally and are fertile.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930533K18Rik T A 10: 70,868,800 noncoding transcript Het
4931409K22Rik C T 5: 24,549,762 V337M possibly damaging Het
Alox5 A G 6: 116,423,330 probably benign Het
Anxa11 T A 14: 25,873,997 D203E probably damaging Het
Atp12a A T 14: 56,374,481 N371Y probably damaging Het
Bloc1s6 A G 2: 122,742,623 I39M probably benign Het
Celsr3 A C 9: 108,834,655 I1688L possibly damaging Het
Cgn T C 3: 94,774,894 probably benign Het
Chd4 A T 6: 125,102,967 I453F probably damaging Het
Dbnl A G 11: 5,797,321 T247A probably benign Het
Dpysl3 T C 18: 43,438,071 E46G possibly damaging Het
Dsg1a T C 18: 20,335,892 probably benign Het
Fbp1 C T 13: 62,871,285 E150K probably benign Het
Flnb T A 14: 7,927,352 L1854Q probably damaging Het
Gcn1l1 C T 5: 115,589,303 T714M probably benign Het
Gm12216 A T 11: 53,813,336 probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Hmbs T A 9: 44,337,360 H256L probably benign Het
Ibsp A T 5: 104,310,020 probably null Het
Ints13 A G 6: 146,552,461 V240A probably benign Het
Kalrn T C 16: 34,032,467 D343G probably damaging Het
Kin T C 2: 10,085,720 probably benign Het
Klhdc1 T C 12: 69,258,030 V192A probably benign Het
Lpar3 T A 3: 146,240,671 C35S possibly damaging Het
Lrrtm4 A G 6: 80,021,970 I122V possibly damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mgat4c T C 10: 102,388,591 M222T probably damaging Het
Muc4 C A 16: 32,751,670 S516Y possibly damaging Het
Myo1e A T 9: 70,367,674 Q703L probably damaging Het
Neb A G 2: 52,225,558 probably benign Het
Necab3 T G 2: 154,546,303 E239A probably null Het
Npr1 G T 3: 90,461,369 N461K probably benign Het
Olfr1294 T C 2: 111,537,627 I221V probably damaging Het
Pcdhb2 A G 18: 37,295,490 Y172C probably damaging Het
Pcdhb7 A G 18: 37,341,901 D30G probably benign Het
Phf12 A C 11: 78,029,332 Q898P probably benign Het
Plekhn1 T C 4: 156,225,364 E132G possibly damaging Het
Ptpn3 A G 4: 57,270,075 V29A probably benign Het
Rundc3b T A 5: 8,569,529 I143F probably damaging Het
Ryr3 T G 2: 112,648,306 probably benign Het
Sash1 A G 10: 8,751,137 probably null Het
Slc4a2 A G 5: 24,431,259 D201G probably benign Het
Tecpr1 T A 5: 144,214,053 probably null Het
Tmem79 T C 3: 88,332,934 T236A probably damaging Het
Usp34 G T 11: 23,472,967 V3095F probably damaging Het
Vmn1r8 A T 6: 57,036,588 Q208L probably benign Het
Other mutations in Timm21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Timm21 APN 18 84951275 missense probably benign 0.00
R0238:Timm21 UTSW 18 84947666 missense probably damaging 1.00
R0238:Timm21 UTSW 18 84947666 missense probably damaging 1.00
R0918:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R0919:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R1384:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R1740:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R1743:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R1873:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R1875:Timm21 UTSW 18 84949262 missense probably damaging 1.00
R2875:Timm21 UTSW 18 84951092 missense probably benign
R5022:Timm21 UTSW 18 84949414 missense possibly damaging 0.95
R5023:Timm21 UTSW 18 84949414 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCCAACTTTCAACTCTCTTGGCGAC -3'
(R):5'- CCAGCAAGCACATGAATGCCTTTAC -3'

Sequencing Primer
(F):5'- ATGCCTGAGACCTGATGATGC -3'
(R):5'- GCACATGAATGCCTTTACATAGC -3'
Posted On2014-09-17