Incidental Mutation 'R1216:Guca1a'
ID226161
Institutional Source Beutler Lab
Gene Symbol Guca1a
Ensembl Gene ENSMUSG00000023982
Gene Nameguanylate cyclase activator 1a (retina)
SynonymsmGCAP1, Guca1
MMRRC Submission 039285-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1216 (G1)
Quality Score30
Status Validated
Chromosome17
Chromosomal Location47394560-47400584 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 47395712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024774] [ENSMUST00000059348] [ENSMUST00000145462]
Predicted Effect probably benign
Transcript: ENSMUST00000024774
SMART Domains Protein: ENSMUSP00000024774
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
EFh 146 174 5.83e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059348
SMART Domains Protein: ENSMUSP00000060027
Gene: ENSMUSG00000023982

DomainStartEndE-ValueType
EFh 55 83 3.01e-5 SMART
EFh 91 119 2.44e-5 SMART
EFh 135 163 5.83e-3 SMART
low complexity region 166 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145462
SMART Domains Protein: ENSMUSP00000126799
Gene: ENSMUSG00000023979

DomainStartEndE-ValueType
EFh 57 85 6.35e-4 SMART
EFh 93 121 3.65e-4 SMART
low complexity region 180 190 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: This gene encodes a calcium-binding photoreceptor protein. The encoded protein may be involved in modulation of guanylyl cyclase activity, and in turn, the mammalian cone phototransduction cascade. Disruption of this gene results in the retinal degeneration associated with cone dystrophy. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele exhibit photoreceptor degeneration and loss of cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,798,492 D332V probably damaging Het
Akr1c12 T C 13: 4,276,323 Y53C probably benign Het
Arhgap23 T C 11: 97,492,672 probably benign Het
AU040320 T C 4: 126,816,483 probably benign Het
B4galnt2 A G 11: 95,891,941 L15P probably benign Het
Cadps2 A G 6: 23,583,473 probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dppa4 T C 16: 48,292,980 F244S possibly damaging Het
Exoc1 A G 5: 76,554,188 K445R probably benign Het
Fam47e A G 5: 92,562,484 E114G probably damaging Het
Fgf12 A T 16: 28,162,450 N171K possibly damaging Het
Fyb2 G A 4: 104,995,706 V528M possibly damaging Het
Ghr A G 15: 3,319,855 S614P probably damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gpr152 T A 19: 4,143,555 V365D possibly damaging Het
Hivep1 G A 13: 42,157,521 G1079D probably benign Het
Hnrnpm T C 17: 33,649,713 D580G probably damaging Het
Ints6 A T 14: 62,707,698 D394E probably damaging Het
Kat6b T A 14: 21,622,040 Y339* probably null Het
Kcnj11 C A 7: 46,099,861 V13L probably benign Het
Lama3 C T 18: 12,421,134 probably benign Het
Myo18a A G 11: 77,818,647 T161A probably benign Het
Ncapg G T 5: 45,699,919 S991I possibly damaging Het
Nrde2 G A 12: 100,149,810 probably benign Het
Olfr1262 T A 2: 90,002,478 I24N probably benign Het
Olfr73 T C 2: 88,034,258 R294G probably damaging Het
Pcdhb7 A T 18: 37,343,874 T688S probably damaging Het
Pla2g6 T C 15: 79,306,435 D309G probably benign Het
Plod1 A T 4: 147,921,127 V404D probably damaging Het
Ppp2r2a G T 14: 67,028,998 Y71* probably null Het
Prcp A G 7: 92,917,746 N222S probably benign Het
Rad21 T C 15: 51,970,136 T316A possibly damaging Het
Ranbp2 T C 10: 58,483,212 probably benign Het
Rapgef4 C A 2: 72,208,148 P548T possibly damaging Het
Ric1 G T 19: 29,577,735 M416I probably benign Het
Skiv2l2 A G 13: 112,914,342 probably benign Het
Slc9a8 T C 2: 167,424,121 F6S probably benign Het
Smpdl3a T G 10: 57,802,479 I126S probably null Het
Sphkap A T 1: 83,290,977 L98Q probably damaging Het
Spink4 T G 4: 40,924,974 probably benign Het
Taar5 A T 10: 23,971,707 L334F probably damaging Het
Tecta A T 9: 42,377,907 I454K probably benign Het
Ttc7 C T 17: 87,346,578 T561M possibly damaging Het
Vmn2r9 G T 5: 108,847,574 H403N probably damaging Het
Zdbf2 G A 1: 63,303,002 C180Y possibly damaging Het
Other mutations in Guca1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Guca1a APN 17 47400384 missense probably damaging 0.99
IGL01684:Guca1a APN 17 47395143 missense probably null 0.83
IGL01969:Guca1a APN 17 47400343 missense probably damaging 0.99
IGL02441:Guca1a APN 17 47394653 unclassified probably benign
IGL03273:Guca1a APN 17 47395173 missense probably benign 0.00
R1666:Guca1a UTSW 17 47400242 missense probably damaging 1.00
R4849:Guca1a UTSW 17 47394737 missense possibly damaging 0.82
R5433:Guca1a UTSW 17 47400370 missense probably damaging 0.99
R6996:Guca1a UTSW 17 47395177 missense probably benign 0.05
Z1088:Guca1a UTSW 17 47400410 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTACCCGGATGATGGTGAGCAG -3'
(R):5'- CTTAGTGGAGCTTGAAGCCAAGAGG -3'

Sequencing Primer
(F):5'- AGCAGCTCGTCCCTGTC -3'
(R):5'- CTAACAGACTTGATTGGCAGC -3'
Posted On2014-09-17