Incidental Mutation 'R2049:Kmt2c'
ID226210
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Namelysine (K)-specific methyltransferase 2C
SynonymsMll3, E330008K23Rik, HALR
MMRRC Submission 040056-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R2049 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25271798-25498783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25285079 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 4287 (Q4287H)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000174734]
Predicted Effect probably damaging
Transcript: ENSMUST00000045291
AA Change: Q4287H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: Q4287H

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172556
AA Change: Q1134H
SMART Domains Protein: ENSMUSP00000133941
Gene: ENSMUSG00000038056
AA Change: Q1134H

DomainStartEndE-ValueType
SCOP:d2spca_ 84 177 1e-3 SMART
low complexity region 196 209 N/A INTRINSIC
coiled coil region 307 345 N/A INTRINSIC
low complexity region 379 405 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 568 586 N/A INTRINSIC
low complexity region 688 702 N/A INTRINSIC
low complexity region 735 752 N/A INTRINSIC
low complexity region 842 857 N/A INTRINSIC
low complexity region 863 886 N/A INTRINSIC
low complexity region 1141 1157 N/A INTRINSIC
low complexity region 1260 1267 N/A INTRINSIC
PHD 1302 1348 2.94e-2 SMART
FYRN 1402 1445 1.18e-21 SMART
FYRC 1451 1538 4.54e-32 SMART
SET 1608 1730 3.17e-34 SMART
PostSET 1732 1748 1.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173673
Predicted Effect probably benign
Transcript: ENSMUST00000174734
AA Change: Q907H

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133482
Gene: ENSMUSG00000038056
AA Change: Q907H

DomainStartEndE-ValueType
low complexity region 49 75 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
low complexity region 358 372 N/A INTRINSIC
low complexity region 411 416 N/A INTRINSIC
low complexity region 449 458 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
low complexity region 1032 1039 N/A INTRINSIC
PHD 1074 1120 2.94e-2 SMART
FYRN 1174 1217 1.18e-21 SMART
FYRC 1223 1310 4.54e-32 SMART
SET 1384 1506 3.17e-34 SMART
PostSET 1508 1524 1.82e-6 SMART
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (118/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,584,987 R8* probably null Het
Abhd17a A G 10: 80,585,606 probably null Het
Acsm1 A G 7: 119,656,039 R415G probably damaging Het
Acta1 G T 8: 123,892,064 T360N probably benign Het
Adam6a T A 12: 113,544,429 S141T probably benign Het
Adgrd1 G T 5: 129,115,095 K76N probably benign Het
Afdn A G 17: 13,810,433 E202G probably damaging Het
Agps T A 2: 75,858,926 M156K probably benign Het
Agxt A G 1: 93,137,315 I149V probably benign Het
Aqp2 A G 15: 99,579,366 T72A probably damaging Het
Arhgap18 T A 10: 26,849,942 D54E probably benign Het
Asb8 C A 15: 98,136,069 E202* probably null Het
Bmp5 A G 9: 75,893,790 I401V probably damaging Het
Bscl2 T C 19: 8,845,320 probably null Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Cd55 C T 1: 130,449,423 V333I probably benign Het
Cep112 A G 11: 108,606,325 E697G probably damaging Het
Cerk G A 15: 86,142,808 S167L probably benign Het
Chrm3 T A 13: 9,878,335 I222F probably damaging Het
Clcn6 A G 4: 148,024,137 F145S possibly damaging Het
Cnksr1 A G 4: 134,229,628 Y488H probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Commd10 A T 18: 46,963,747 T74S probably benign Het
Cyp4f39 T C 17: 32,482,138 F201L probably benign Het
Dennd4a A G 9: 64,889,605 T860A possibly damaging Het
Dlg5 A T 14: 24,154,647 I1253N probably damaging Het
Dnah7b T A 1: 46,268,670 M3048K probably damaging Het
Dnah9 A G 11: 66,044,683 M1970T probably damaging Het
Doxl2 T A 6: 48,977,755 L609* probably null Het
Dsc3 A T 18: 19,989,680 D62E possibly damaging Het
Dsel T C 1: 111,859,457 N1116S probably benign Het
Dusp7 C T 9: 106,373,897 T407M probably damaging Het
Efnb1 A G X: 99,147,517 Y343C probably damaging Het
Entpd5 A G 12: 84,396,858 I12T probably benign Het
Espn T C 4: 152,121,257 E408G probably damaging Het
Fam160a2 A T 7: 105,389,839 D64E probably damaging Het
Gdpd3 A G 7: 126,768,594 T200A probably damaging Het
Gli1 A G 10: 127,336,727 L182P probably damaging Het
Gm4907 T A X: 23,907,310 V350E probably benign Het
Gm5134 G A 10: 76,004,884 A521T possibly damaging Het
Gm8300 A G 12: 87,517,276 D127G unknown Het
Gm960 A G 19: 4,698,605 probably benign Het
Gprasp1 G A X: 135,802,042 E995K possibly damaging Het
H2-M10.1 T C 17: 36,325,216 D153G possibly damaging Het
Helb A T 10: 120,106,021 M254K possibly damaging Het
I0C0044D17Rik A G 4: 98,820,296 probably benign Het
Igfn1 T A 1: 135,970,638 Q730L probably benign Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Jmjd1c T A 10: 67,157,998 L86* probably null Het
Kat5 T A 19: 5,605,685 probably null Het
Kif14 A G 1: 136,487,080 N768S probably benign Het
Kif14 A G 1: 136,510,167 E1199G possibly damaging Het
Klhl29 A G 12: 5,137,876 S163P probably damaging Het
Krt82 T A 15: 101,545,156 Q265L probably damaging Het
Macf1 C T 4: 123,355,102 C7210Y probably damaging Het
Mx2 G A 16: 97,538,703 E20K probably benign Het
Myom2 T G 8: 15,106,379 I742S probably damaging Het
Narf A T 11: 121,250,369 R310* probably null Het
Nktr T A 9: 121,741,694 D167E probably damaging Het
Nle1 A G 11: 82,905,366 W183R probably damaging Het
Npas3 A G 12: 54,062,088 N425S probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1197 A T 2: 88,728,745 Y285N probably damaging Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr283 G A 15: 98,378,396 T238I possibly damaging Het
Olfr816 A G 10: 129,912,167 V37A probably benign Het
Olfr965 A T 9: 39,720,115 D296V probably damaging Het
Olfr984 T A 9: 40,101,119 I124L probably benign Het
Optc A T 1: 133,903,796 probably null Het
Otol1 T A 3: 70,018,836 F115I probably benign Het
Parp8 T A 13: 116,894,886 D430V probably benign Het
Pex7 T A 10: 19,894,315 H123L probably damaging Het
Pkhd1l1 T A 15: 44,547,513 probably benign Het
Pkhd1l1 G A 15: 44,581,741 D3670N probably damaging Het
Plec T C 15: 76,183,174 T1331A probably benign Het
Plekha4 A G 7: 45,553,798 D704G probably benign Het
Plxnb2 T A 15: 89,159,002 N1453I probably damaging Het
Pms1 T A 1: 53,281,988 I29F probably damaging Het
Ppp1r1a G A 15: 103,531,406 T153I probably damaging Het
Pramef8 T A 4: 143,416,871 L69Q probably damaging Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Ptpre A G 7: 135,670,695 probably benign Het
Ptprt A T 2: 161,534,545 I1312N probably damaging Het
Ren1 C G 1: 133,350,778 probably null Het
Rims1 C T 1: 22,596,435 C155Y probably damaging Het
Slitrk6 T G 14: 110,750,794 T494P probably benign Het
Sltm G A 9: 70,581,301 G578S probably benign Het
Smyd5 A G 6: 85,444,318 E338G probably benign Het
Snx2 G A 18: 53,194,444 V81M probably damaging Het
Sp2 G T 11: 96,961,365 N244K probably benign Het
Sspo C A 6: 48,460,763 probably benign Het
Sspo A C 6: 48,463,531 D1568A probably benign Het
Ssrp1 T C 2: 85,041,427 probably benign Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Syt7 G A 19: 10,439,213 R138Q probably benign Het
Taar7f T C 10: 24,050,425 Y306H possibly damaging Het
Tbccd1 T C 16: 22,818,541 probably null Het
Tex261 A G 6: 83,772,259 Y119H probably damaging Het
Tmem131l T G 3: 83,942,788 E234D probably damaging Het
Tnnt2 TG TGG 1: 135,846,761 probably benign Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubap1 C T 4: 41,379,257 A157V probably damaging Het
Ubr4 C T 4: 139,477,207 T4810M probably damaging Het
Uso1 G A 5: 92,181,936 G427R probably damaging Het
Usp15 A T 10: 123,119,137 V912D probably damaging Het
Vmn1r20 T C 6: 57,431,958 S90P probably damaging Het
Vmn1r32 T C 6: 66,553,561 K77R probably damaging Het
Vmn2r100 A G 17: 19,522,050 K229E probably benign Het
Vmn2r106 A G 17: 20,268,304 V611A possibly damaging Het
Xrcc6 T A 15: 82,022,977 F167I probably damaging Het
Zbtb21 G T 16: 97,950,155 P804H probably damaging Het
Zdhhc3 T C 9: 123,100,537 D11G probably damaging Het
Zfhx3 A G 8: 108,945,177 T1324A probably benign Het
Zfp281 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC 1: 136,625,353 probably benign Het
Zfp608 G T 18: 54,895,565 L1259I probably damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0671:Kmt2c UTSW 5 25404365 missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2079:Kmt2c UTSW 5 25352280 missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R4983:Kmt2c UTSW 5 25295511 missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGCTTAAAGGTCCCCTTGG -3'
(R):5'- CATCAGTAGACTTGCTTTACTGGC -3'

Sequencing Primer
(F):5'- CTTGGGGATGACAATATGAATGCTCC -3'
(R):5'- GCTTTACTGGCAAGTGAATCC -3'
Posted On2014-09-17