Incidental Mutation 'R0147:Col6a5'
ID22626
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission 038431-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R0147 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105925794 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1324 (D1324G)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect unknown
Transcript: ENSMUST00000165165
AA Change: D1324G
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: D1324G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190193
AA Change: D1324G
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: D1324G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.5%
  • 20x: 86.1%
Validation Efficiency 67% (88/131)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik C T 18: 12,189,271 R594C probably damaging Het
A2m T C 6: 121,662,446 probably null Het
Abtb2 A G 2: 103,567,135 I137V probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Arl6 T C 16: 59,618,790 probably benign Het
Avl9 T A 6: 56,736,502 D248E probably benign Het
Becn1 T C 11: 101,301,736 E40G probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Btbd16 C T 7: 130,779,594 T19I probably damaging Het
Casc3 T A 11: 98,822,499 N246K possibly damaging Het
Celf1 G T 2: 91,004,690 probably benign Het
Chrm3 G T 13: 9,878,744 N85K probably damaging Het
Cluh T A 11: 74,665,938 Y935N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
D630003M21Rik C T 2: 158,203,067 probably benign Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dnmt3b T G 2: 153,661,457 N9K possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam208a A G 14: 27,471,768 D975G probably benign Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fam98c T A 7: 29,152,721 R340* probably null Het
Fbxw10 T G 11: 62,847,481 probably null Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Grid2 T C 6: 64,533,587 Y734H probably benign Het
Grm6 T A 11: 50,859,317 I466N possibly damaging Het
Hectd3 T C 4: 116,997,040 probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Ip6k1 T A 9: 108,045,894 D408E probably damaging Het
Irs2 A T 8: 11,007,568 M288K probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Knop1 C A 7: 118,845,838 R301L probably benign Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mprip T A 11: 59,737,073 D93E possibly damaging Het
Mtmr14 T A 6: 113,260,666 probably benign Het
Muc5ac T C 7: 141,811,039 S1917P probably benign Het
Muc6 C T 7: 141,651,990 C75Y probably damaging Het
Naip1 A T 13: 100,426,910 H582Q possibly damaging Het
Nbeal2 G A 9: 110,642,143 R264* probably null Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nsmce2 T G 15: 59,378,957 S26A probably damaging Het
Olfr1026 T A 2: 85,924,018 I250N possibly damaging Het
Olfr601 T C 7: 103,358,406 T263A possibly damaging Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pax1 A G 2: 147,373,734 S424G probably benign Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Plxna1 C T 6: 89,320,710 A1831T possibly damaging Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Pygo2 T C 3: 89,433,303 V299A probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rnf13 A G 3: 57,802,468 D144G probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Sec23ip C T 7: 128,779,051 probably benign Het
Slc25a26 T A 6: 94,592,526 probably null Het
Slc6a7 A G 18: 61,002,111 probably benign Het
Slco6b1 A T 1: 96,987,837 noncoding transcript Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Spata22 T A 11: 73,331,153 M1K probably null Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tm9sf4 G T 2: 153,195,313 V365L probably benign Het
Tmc3 T C 7: 83,607,742 V401A probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Unc5b A T 10: 60,772,297 S675T probably damaging Het
Vmn1r217 A G 13: 23,113,937 M265T probably benign Het
Vps54 T A 11: 21,300,259 D548E probably benign Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfp710 T A 7: 80,081,973 C299* probably null Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1863:Col6a5 UTSW 9 105940201 missense unknown
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAAGCTCCACTGTGTGCATC -3'
(R):5'- TCGACATTTCCACTCACCGTCAGG -3'

Sequencing Primer
(F):5'- CCAGCAAGGTGATGCTTTC -3'
(R):5'- TTGGAGGACATCACCTCTATCAG -3'
Posted On2013-04-16