Incidental Mutation 'R2050:Trank1'
ID226347
Institutional Source Beutler Lab
Gene Symbol Trank1
Ensembl Gene ENSMUSG00000062296
Gene Nametetratricopeptide repeat and ankyrin repeat containing 1
SynonymsA230061D21Rik, LOC235639, C030048J01Rik, Lba1
MMRRC Submission 040057-MU
Accession Numbers

Genbank: NM_001164659.1; Ensembl: ENSMUST00000078626

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2050 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location111311739-111395775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111364788 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 627 (H627N)
Ref Sequence ENSEMBL: ENSMUSP00000077697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078626]
Predicted Effect probably damaging
Transcript: ENSMUST00000078626
AA Change: H627N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077697
Gene: ENSMUSG00000062296
AA Change: H627N

DomainStartEndE-ValueType
low complexity region 4 30 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 113 129 N/A INTRINSIC
Blast:TPR 144 177 1e-15 BLAST
Blast:TPR 178 209 8e-13 BLAST
Blast:ANK 332 361 1e-6 BLAST
ANK 369 405 5.29e0 SMART
ANK 538 567 2.11e2 SMART
ANK 572 609 7.29e2 SMART
ANK 621 652 1.21e2 SMART
low complexity region 887 895 N/A INTRINSIC
low complexity region 1152 1172 N/A INTRINSIC
Blast:AAA 1351 1569 1e-6 BLAST
low complexity region 2166 2177 N/A INTRINSIC
low complexity region 2395 2411 N/A INTRINSIC
low complexity region 2636 2649 N/A INTRINSIC
low complexity region 2966 2983 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T C 5: 31,486,058 I44T possibly damaging Het
Agap2 G T 10: 127,080,261 E214* probably null Het
Angpt2 G T 8: 18,705,657 P265T probably benign Het
Apc2 C A 10: 80,307,609 probably null Het
Arpc1b C T 5: 145,125,919 P250S probably damaging Het
Atxn10 T G 15: 85,365,312 V115G probably benign Het
Bace2 T A 16: 97,412,136 C100S probably damaging Het
Bpifb9b T C 2: 154,309,604 S82P possibly damaging Het
Cacna1g A G 11: 94,409,474 S2157P probably damaging Het
Cacnb4 T A 2: 52,469,586 I104L probably damaging Het
Cdh6 T A 15: 13,057,501 M245L probably benign Het
Celsr1 A C 15: 86,030,547 V1075G probably benign Het
Cfap61 T C 2: 146,145,473 F1065L probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Colgalt1 T C 8: 71,617,686 probably null Het
Ctnnal1 A T 4: 56,835,350 V309D probably benign Het
D7Ertd443e T A 7: 134,266,798 E659D probably damaging Het
Dab2 T C 15: 6,435,215 Y516H possibly damaging Het
Dnah14 T C 1: 181,752,562 L3099P probably damaging Het
Frem3 A G 8: 80,614,891 E1271G probably damaging Het
Gm14085 T C 2: 122,522,868 S510P probably benign Het
Grap2 A G 15: 80,646,243 H188R probably benign Het
Grin2c T C 11: 115,257,419 D344G possibly damaging Het
Hmcn2 T C 2: 31,335,436 M119T probably damaging Het
Hsd11b2 A G 8: 105,523,360 I368V probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifit1bl2 T A 19: 34,619,470 N249Y possibly damaging Het
Igsf8 T A 1: 172,318,865 Y36N probably damaging Het
Lrp12 G A 15: 39,872,589 S649L probably damaging Het
Map2 T C 1: 66,414,314 S788P probably damaging Het
Mast4 T C 13: 102,751,409 D1164G probably damaging Het
Mcm9 A G 10: 53,612,825 probably null Het
Myo5a G A 9: 75,146,874 E355K probably benign Het
Myo9b T A 8: 71,290,550 V85E probably damaging Het
Nbeal1 G A 1: 60,292,964 probably null Het
Nlrx1 A T 9: 44,262,780 W375R probably damaging Het
Pik3c2a A G 7: 116,417,451 probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Plk4 T A 3: 40,810,380 M603K probably benign Het
Rfx7 T A 9: 72,617,466 V646E probably benign Het
Slc9a1 A G 4: 133,416,334 H377R probably benign Het
Snrnp70 A C 7: 45,387,300 Y61* probably null Het
Spatc1l T C 10: 76,564,058 L138P probably damaging Het
Spink5 T C 18: 44,007,758 probably null Het
Sptan1 T A 2: 30,002,238 S1055T probably benign Het
Tas2r104 T A 6: 131,685,120 M209L probably damaging Het
Tdrd12 C T 7: 35,529,247 V17I probably damaging Het
Tmem129 C A 5: 33,657,782 A16S probably benign Het
Tmtc1 T C 6: 148,262,883 E584G probably damaging Het
Trio T C 15: 27,851,945 D820G possibly damaging Het
Trpt1 T A 19: 6,998,084 N98K probably damaging Het
Ube4b A T 4: 149,344,612 F857I probably damaging Het
Vmn2r45 A G 7: 8,472,022 V669A probably damaging Het
Vmn2r71 A G 7: 85,624,473 I832V probably damaging Het
Zbtb20 T A 16: 43,609,612 probably null Het
Zfyve9 A C 4: 108,718,603 M427R probably benign Het
Zfyve9 A T 4: 108,719,303 F194I possibly damaging Het
Other mutations in Trank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Trank1 APN 9 111392609 missense probably damaging 1.00
IGL00467:Trank1 APN 9 111364666 splice site probably benign
IGL00569:Trank1 APN 9 111345511 missense possibly damaging 0.69
IGL00585:Trank1 APN 9 111349290 missense possibly damaging 0.82
IGL01070:Trank1 APN 9 111366793 missense probably damaging 1.00
IGL01134:Trank1 APN 9 111391781 missense probably benign
IGL01154:Trank1 APN 9 111386400 missense probably benign 0.00
IGL01355:Trank1 APN 9 111365520 missense possibly damaging 0.94
IGL01407:Trank1 APN 9 111364722 missense probably damaging 0.99
IGL01410:Trank1 APN 9 111365049 missense probably benign 0.00
IGL01410:Trank1 APN 9 111365259 missense probably benign 0.00
IGL01504:Trank1 APN 9 111373544 missense probably damaging 1.00
IGL01744:Trank1 APN 9 111349363 missense probably damaging 1.00
IGL02043:Trank1 APN 9 111363960 missense probably damaging 0.98
IGL02104:Trank1 APN 9 111390712 missense possibly damaging 0.85
IGL02193:Trank1 APN 9 111367276 missense probably benign 0.43
IGL02581:Trank1 APN 9 111383125 missense probably benign 0.00
IGL02630:Trank1 APN 9 111373075 missense possibly damaging 0.70
IGL02839:Trank1 APN 9 111364756 missense probably damaging 1.00
IGL02897:Trank1 APN 9 111367517 missense probably damaging 0.99
IGL03065:Trank1 APN 9 111390293 missense possibly damaging 0.64
IGL03123:Trank1 APN 9 111367407 missense probably damaging 1.00
IGL03143:Trank1 APN 9 111366087 missense probably damaging 1.00
IGL03323:Trank1 APN 9 111352116 missense probably damaging 1.00
1mM(1):Trank1 UTSW 9 111392981 missense probably damaging 1.00
R0035:Trank1 UTSW 9 111366776 missense probably benign 0.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0064:Trank1 UTSW 9 111343195 missense probably damaging 1.00
R0089:Trank1 UTSW 9 111392910 missense probably benign 0.00
R0207:Trank1 UTSW 9 111366253 missense probably damaging 1.00
R0255:Trank1 UTSW 9 111366024 missense possibly damaging 0.92
R0334:Trank1 UTSW 9 111365353 missense probably benign 0.00
R0334:Trank1 UTSW 9 111392940 missense probably damaging 1.00
R0383:Trank1 UTSW 9 111391477 missense probably benign 0.08
R0421:Trank1 UTSW 9 111391839 missense probably damaging 1.00
R0494:Trank1 UTSW 9 111391293 missense probably benign 0.19
R0518:Trank1 UTSW 9 111333808 missense probably damaging 1.00
R0560:Trank1 UTSW 9 111391086 missense possibly damaging 0.88
R0637:Trank1 UTSW 9 111390441 missense probably damaging 1.00
R0731:Trank1 UTSW 9 111365488 missense probably damaging 1.00
R0761:Trank1 UTSW 9 111366613 missense probably damaging 1.00
R0766:Trank1 UTSW 9 111347469 missense probably benign 0.45
R0827:Trank1 UTSW 9 111349417 unclassified probably benign
R1005:Trank1 UTSW 9 111333721 missense probably benign 0.13
R1108:Trank1 UTSW 9 111365307 missense probably benign 0.00
R1155:Trank1 UTSW 9 111366970 missense possibly damaging 0.95
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1470:Trank1 UTSW 9 111343232 missense possibly damaging 0.91
R1596:Trank1 UTSW 9 111366290 missense possibly damaging 0.93
R1601:Trank1 UTSW 9 111373477 missense probably damaging 1.00
R1751:Trank1 UTSW 9 111391479 missense probably benign
R1754:Trank1 UTSW 9 111392871 missense probably benign 0.00
R1767:Trank1 UTSW 9 111391479 missense probably benign
R1768:Trank1 UTSW 9 111392927 missense probably damaging 0.96
R1809:Trank1 UTSW 9 111392825 missense probably benign 0.34
R1912:Trank1 UTSW 9 111390709 missense probably benign 0.00
R1920:Trank1 UTSW 9 111347928 critical splice donor site probably null
R1960:Trank1 UTSW 9 111391628 missense probably damaging 1.00
R1993:Trank1 UTSW 9 111378832 missense probably benign 0.20
R2012:Trank1 UTSW 9 111365028 missense probably benign
R2025:Trank1 UTSW 9 111392039 missense probably benign 0.01
R2857:Trank1 UTSW 9 111366933 missense probably benign 0.00
R2912:Trank1 UTSW 9 111392483 missense probably damaging 0.98
R2962:Trank1 UTSW 9 111352080 missense probably damaging 1.00
R3030:Trank1 UTSW 9 111391530 missense possibly damaging 0.63
R3821:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3822:Trank1 UTSW 9 111378819 missense probably damaging 1.00
R3892:Trank1 UTSW 9 111364759 missense probably benign 0.03
R4105:Trank1 UTSW 9 111352197 missense probably damaging 1.00
R4166:Trank1 UTSW 9 111373524 nonsense probably null
R4237:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4239:Trank1 UTSW 9 111367035 missense probably benign 0.04
R4394:Trank1 UTSW 9 111365197 missense possibly damaging 0.86
R4417:Trank1 UTSW 9 111365968 missense probably benign 0.17
R4611:Trank1 UTSW 9 111362261 missense probably damaging 1.00
R4694:Trank1 UTSW 9 111392061 missense probably benign 0.40
R4731:Trank1 UTSW 9 111390410 missense probably damaging 1.00
R4843:Trank1 UTSW 9 111366078 missense probably benign 0.00
R4852:Trank1 UTSW 9 111391895 missense possibly damaging 0.68
R4859:Trank1 UTSW 9 111365010 missense probably benign 0.17
R4868:Trank1 UTSW 9 111365641 missense probably damaging 1.00
R5080:Trank1 UTSW 9 111389221 missense probably damaging 0.99
R5156:Trank1 UTSW 9 111390694 missense probably damaging 1.00
R5174:Trank1 UTSW 9 111365559 missense probably benign 0.00
R5234:Trank1 UTSW 9 111386467 missense probably damaging 1.00
R5386:Trank1 UTSW 9 111362402 missense probably benign 0.12
R5419:Trank1 UTSW 9 111391301 missense probably damaging 1.00
R5435:Trank1 UTSW 9 111391890 missense probably benign 0.00
R5444:Trank1 UTSW 9 111392958 missense probably benign 0.04
R5543:Trank1 UTSW 9 111366112 missense probably damaging 0.97
R5560:Trank1 UTSW 9 111390567 missense probably damaging 1.00
R5772:Trank1 UTSW 9 111366676 missense possibly damaging 0.86
R5774:Trank1 UTSW 9 111391226 missense probably damaging 1.00
R5843:Trank1 UTSW 9 111365860 missense possibly damaging 0.59
R5858:Trank1 UTSW 9 111392536 missense probably benign
R5878:Trank1 UTSW 9 111366685 missense possibly damaging 0.93
R5900:Trank1 UTSW 9 111391716 missense probably damaging 1.00
R5917:Trank1 UTSW 9 111362417 missense probably benign 0.38
R5954:Trank1 UTSW 9 111365133 missense probably benign 0.13
R6041:Trank1 UTSW 9 111377796 missense possibly damaging 0.94
R6112:Trank1 UTSW 9 111391737 missense probably damaging 1.00
R6165:Trank1 UTSW 9 111391872 missense probably benign 0.00
R6255:Trank1 UTSW 9 111352246 critical splice donor site probably null
R6395:Trank1 UTSW 9 111367200 missense probably damaging 1.00
R6567:Trank1 UTSW 9 111347521 missense probably benign 0.02
R6644:Trank1 UTSW 9 111364834 missense possibly damaging 0.85
R6724:Trank1 UTSW 9 111365916 missense probably damaging 1.00
R6788:Trank1 UTSW 9 111390679 missense probably damaging 1.00
R6831:Trank1 UTSW 9 111377899 missense probably benign 0.00
R6934:Trank1 UTSW 9 111373090 missense probably damaging 0.99
X0064:Trank1 UTSW 9 111343236 missense possibly damaging 0.57
Z1088:Trank1 UTSW 9 111364710 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTATGAGTCCTGTCCCCTG -3'
(R):5'- AGCTGAGATGTATGGCCAGG -3'

Sequencing Primer
(F):5'- TATGAGTCCTGTCCCCTGAGAAG -3'
(R):5'- GCAGAAGATCTGGAGAGCCTC -3'
Posted On2014-09-17