Incidental Mutation 'R2051:Mavs'
ID226387
Institutional Source Beutler Lab
Gene Symbol Mavs
Ensembl Gene ENSMUSG00000037523
Gene Namemitochondrial antiviral signaling protein
SynonymsIPS-1, D430028G21Rik
MMRRC Submission 040058-MU
Accession Numbers

MGI: 2444773

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131234063-131248025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 131240450 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Proline at position 85 (A85P)
Ref Sequence ENSEMBL: ENSMUSP00000105828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041362] [ENSMUST00000110199] [ENSMUST00000130597]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041362
AA Change: A85P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038339
Gene: ENSMUSG00000037523
AA Change: A85P

DomainStartEndE-ValueType
PDB:3J6C|A 1 93 6e-41 PDB
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110199
AA Change: A85P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105828
Gene: ENSMUSG00000037523
AA Change: A85P

DomainStartEndE-ValueType
Pfam:CARD_2 4 92 1.9e-22 PFAM
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130597
SMART Domains Protein: ENSMUSP00000138401
Gene: ENSMUSG00000037523

DomainStartEndE-ValueType
PDB:3J6C|A 1 52 8e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132694
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral immunity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous and heterozygous mice for mutations display defective innate immunity in response to viral infections. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(5) Gene trapped(6)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Mavs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Mavs APN 2 131246716 missense probably damaging 1.00
IGL01520:Mavs APN 2 131245343 missense probably benign 0.38
IGL01909:Mavs APN 2 131245521 missense probably benign 0.43
IGL01941:Mavs APN 2 131246605 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0045:Mavs UTSW 2 131238831 missense probably damaging 1.00
R0751:Mavs UTSW 2 131246764 missense probably damaging 1.00
R2061:Mavs UTSW 2 131240306 splice site probably benign
R2475:Mavs UTSW 2 131240450 missense probably damaging 1.00
R3883:Mavs UTSW 2 131245298 missense probably benign
R4152:Mavs UTSW 2 131246608 missense probably benign 0.22
R4580:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4619:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4779:Mavs UTSW 2 131240365 missense probably damaging 1.00
R4928:Mavs UTSW 2 131246743 missense probably benign 0.00
R6092:Mavs UTSW 2 131245598 nonsense probably null
R6211:Mavs UTSW 2 131240391 missense probably damaging 0.99
R7024:Mavs UTSW 2 131243131 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAAGCCTAGGCCACCTG -3'
(R):5'- AAGTGCAGCCACACATGAGG -3'

Sequencing Primer
(F):5'- CCACCTGGCCTAAGGAGG -3'
(R):5'- AGTGGCTCAGCTGGATCTAAATC -3'
Posted On2014-09-17