Incidental Mutation 'R2051:Iqgap3'
ID226393
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88120167 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 699 (L699P)
Ref Sequence ENSEMBL: ENSMUSP00000142035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440]
Predicted Effect probably damaging
Transcript: ENSMUST00000071812
AA Change: L1597P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: L1597P

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194440
AA Change: L699P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068
AA Change: L699P

DomainStartEndE-ValueType
Blast:RasGAP 1 67 3e-30 BLAST
RasGAP 79 432 1e-59 SMART
Blast:RasGAP 440 524 5e-10 BLAST
Pfam:RasGAP_C 535 660 5.7e-30 PFAM
low complexity region 693 704 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Ago1 T C 4: 126,460,453 H188R probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense not run
Predicted Primers PCR Primer
(F):5'- CAGATTCTCCGGTGTTTGCC -3'
(R):5'- CACTTCAGCCAAGTAGGACAATTC -3'

Sequencing Primer
(F):5'- GTTTGCCTTGAGTAAGAAACCCGC -3'
(R):5'- ACAATTCCTCTTGGGCGG -3'
Posted On2014-09-17