Incidental Mutation 'R2051:Ago1'
ID226403
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Nameargonaute RISC catalytic subunit 1
SynonymsEif2c1, argonaute 1
MMRRC Submission 040058-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R2051 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126435012-126468583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126460453 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 188 (H188R)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: H188R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: H188R

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,564,185 T98M probably damaging Het
4932414N04Rik G T 2: 68,711,048 K10N possibly damaging Het
Aadat T A 8: 60,507,139 S40T probably benign Het
Abca13 A G 11: 9,328,098 I3093V probably benign Het
Acacb A T 5: 114,245,890 Q2160L probably damaging Het
Acp6 G T 3: 97,168,017 S189I probably benign Het
Actr5 A T 2: 158,632,293 M339L probably benign Het
Adcy1 A T 11: 7,161,885 K917* probably null Het
Adgrg5 C T 8: 94,942,067 R504C probably benign Het
Akap9 T A 5: 3,975,685 C23* probably null Het
Ank3 T C 10: 69,898,090 I728T probably damaging Het
Ankrd50 A G 3: 38,454,493 S1242P probably benign Het
Arhgap29 G A 3: 121,981,860 R84H probably benign Het
Arhgef10 A G 8: 14,945,320 D7G probably null Het
Arid4b A G 13: 14,187,645 E898G probably damaging Het
Atrnl1 A G 19: 57,691,849 N727S probably benign Het
Baalc G T 15: 38,933,234 probably benign Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Chpf2 G T 5: 24,591,276 V407L probably benign Het
Chrnb3 C A 8: 27,386,811 N84K probably damaging Het
Cnot1 A G 8: 95,724,593 F2171L possibly damaging Het
Csmd3 C T 15: 48,621,993 probably null Het
Cux1 T A 5: 136,332,658 Q138L probably damaging Het
Cyp2c65 A G 19: 39,082,231 N286S probably benign Het
Dclre1b T C 3: 103,809,040 S17G possibly damaging Het
Dlgap5 A G 14: 47,411,484 S221P probably benign Het
Dnah1 T G 14: 31,279,123 T2422P probably damaging Het
Enpp1 A G 10: 24,711,804 probably null Het
Erbb2 T C 11: 98,420,172 C53R probably damaging Het
Exoc8 A G 8: 124,895,480 V716A probably benign Het
Fam193a T A 5: 34,462,150 D766E probably benign Het
Fbxo43 C A 15: 36,162,132 G310W probably damaging Het
Fcgbp C T 7: 28,120,360 T2504I probably damaging Het
Fnbp4 C T 2: 90,757,532 P418L probably benign Het
Gjd2 T C 2: 114,011,058 T313A probably damaging Het
Gm12695 T A 4: 96,769,771 R54W probably damaging Het
Gm128 T C 3: 95,240,740 D81G possibly damaging Het
Gm21834 A G 17: 57,741,768 V151A possibly damaging Het
Grhl1 T A 12: 24,586,152 probably null Het
Hcn1 C T 13: 117,976,083 T861I probably damaging Het
Herc6 C A 6: 57,625,976 Q547K probably benign Het
Iqgap3 T C 3: 88,120,167 L699P probably damaging Het
Kank4 T C 4: 98,780,102 D36G probably damaging Het
Kcnk5 A T 14: 20,142,209 S295T probably damaging Het
Krt18 T C 15: 102,029,500 V144A probably benign Het
Krtap9-5 A G 11: 99,949,204 I244V unknown Het
Leng1 T G 7: 3,665,401 N16T probably damaging Het
Lss A G 10: 76,531,878 K15E possibly damaging Het
Mastl G T 2: 23,132,824 A629E possibly damaging Het
Mavs G C 2: 131,240,450 A85P possibly damaging Het
Nav3 T C 10: 109,824,675 D678G probably damaging Het
Nsd3 T G 8: 25,691,089 S906A probably damaging Het
Nsfl1c A G 2: 151,503,082 N118S probably damaging Het
Nup205 T A 6: 35,230,516 M1501K probably benign Het
Olfr1178 C T 2: 88,391,538 T97M possibly damaging Het
Olfr429 T A 1: 174,089,219 Y60N possibly damaging Het
Pax8 A G 2: 24,436,508 S281P probably benign Het
Pds5b T G 5: 150,748,190 I433R probably damaging Het
Peg3 T C 7: 6,712,721 N117D probably damaging Het
Pfkm A T 15: 98,131,692 D728V probably benign Het
Phkb T C 8: 86,049,821 probably null Het
Pkp4 T C 2: 59,334,904 V704A probably benign Het
Ppfia2 T A 10: 106,837,299 S501T probably damaging Het
Ptpru T C 4: 131,819,087 E284G possibly damaging Het
Ror1 C T 4: 100,407,868 R180* probably null Het
Ryr3 T A 2: 112,756,641 Y2666F probably damaging Het
Sec23a C A 12: 58,990,968 probably null Het
Sertad3 C T 7: 27,476,269 Q43* probably null Het
Setd2 C T 9: 110,550,890 H1258Y probably benign Het
Sharpin A G 15: 76,348,207 S177P probably benign Het
Skap1 T C 11: 96,541,463 F86S possibly damaging Het
Slc8a2 T C 7: 16,141,015 I396T probably damaging Het
Slc9a2 T C 1: 40,726,437 F329S probably damaging Het
Slx4ip C T 2: 137,066,205 L161F possibly damaging Het
Sox4 A G 13: 28,952,781 S81P probably damaging Het
Ssc4d G T 5: 135,970,264 S28R probably benign Het
St8sia2 C T 7: 73,943,202 G369S possibly damaging Het
Swt1 T C 1: 151,372,330 Y836C probably damaging Het
Taar7d A G 10: 24,028,006 D262G probably benign Het
Taar8b T A 10: 24,091,314 L327F probably benign Het
Tars A T 15: 11,393,194 L138* probably null Het
Tbcd A T 11: 121,453,670 D75V probably damaging Het
Tesc A G 5: 118,046,329 I25V probably damaging Het
Tmem132e G T 11: 82,440,438 S407I probably damaging Het
Tmem50b C A 16: 91,580,292 A95S possibly damaging Het
Tnr T C 1: 159,892,033 I960T probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn1 G C 5: 120,543,388 P532A probably damaging Het
Tpsb2 T C 17: 25,366,565 probably benign Het
Triobp C A 15: 79,004,540 H1948Q probably damaging Het
Tshb T C 3: 102,777,541 I116V probably benign Het
Ttc13 A T 8: 124,672,211 probably null Het
Usp34 A T 11: 23,464,468 T2804S probably damaging Het
Vmn2r18 A T 5: 151,562,551 C493S possibly damaging Het
Vmn2r2 T C 3: 64,117,345 K605R possibly damaging Het
Vmn2r37 T C 7: 9,217,793 Y357C probably damaging Het
Zc3h6 T G 2: 129,015,618 S686A possibly damaging Het
Zfp608 G A 18: 54,988,314 P67L probably benign Het
Zyg11a T C 4: 108,192,047 probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126459817 missense probably damaging 0.98
IGL02578:Ago1 APN 4 126439531 missense probably benign 0.12
IGL02709:Ago1 APN 4 126453640 nonsense probably null
IGL02810:Ago1 APN 4 126443093 missense probably benign 0.00
IGL03037:Ago1 APN 4 126461794 missense probably benign 0.00
IGL03091:Ago1 APN 4 126459189 missense probably damaging 0.98
IGL03100:Ago1 APN 4 126443171 missense probably benign 0.08
IGL03121:Ago1 APN 4 126460003 missense probably benign 0.00
R0195:Ago1 UTSW 4 126463691 missense probably benign 0.01
R0244:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126443166 missense probably benign 0.06
R0514:Ago1 UTSW 4 126439595 missense probably benign
R0557:Ago1 UTSW 4 126460024 missense probably benign 0.00
R1104:Ago1 UTSW 4 126453633 missense probably damaging 0.99
R1553:Ago1 UTSW 4 126440401 missense probably damaging 0.99
R1624:Ago1 UTSW 4 126463741 missense probably damaging 0.97
R1851:Ago1 UTSW 4 126439995 missense probably benign 0.00
R1867:Ago1 UTSW 4 126441236 missense probably damaging 0.98
R2001:Ago1 UTSW 4 126454394 missense probably null 0.36
R2057:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R2105:Ago1 UTSW 4 126461788 missense probably benign 0.30
R2117:Ago1 UTSW 4 126463857 unclassified probably null
R2256:Ago1 UTSW 4 126441911 missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126453650 missense probably benign 0.01
R2517:Ago1 UTSW 4 126439939 nonsense probably null
R2850:Ago1 UTSW 4 126443075 splice site probably benign
R2993:Ago1 UTSW 4 126440046 splice site probably benign
R3746:Ago1 UTSW 4 126461044 missense probably benign
R3747:Ago1 UTSW 4 126461044 missense probably benign
R3750:Ago1 UTSW 4 126461044 missense probably benign
R4600:Ago1 UTSW 4 126460392 missense probably benign 0.37
R4934:Ago1 UTSW 4 126448859 missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126453654 missense probably damaging 0.99
R5086:Ago1 UTSW 4 126453604 missense probably benign 0.01
R5132:Ago1 UTSW 4 126461723 missense probably benign 0.01
R5239:Ago1 UTSW 4 126441215 missense probably damaging 1.00
R5609:Ago1 UTSW 4 126461037 missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126448794 missense probably benign 0.01
R5980:Ago1 UTSW 4 126460569 unclassified probably benign
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6036:Ago1 UTSW 4 126443228 missense probably damaging 0.98
R6398:Ago1 UTSW 4 126448808 missense probably benign 0.26
R6505:Ago1 UTSW 4 126463835 missense probably benign 0.00
R6545:Ago1 UTSW 4 126454352 missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126460422 missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126463706 missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126439505 makesense probably null
R7496:Ago1 UTSW 4 126461752 missense probably benign 0.20
X0025:Ago1 UTSW 4 126443115 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGGTAGGGATAGCATGGCTC -3'
(R):5'- AGATGGTTAGACCCCTGGCC -3'

Sequencing Primer
(F):5'- AGCATGGCTCAGATTCTTTCAG -3'
(R):5'- AGGTCAGTCTTACTATTGGCCCAAG -3'
Posted On2014-09-17