Incidental Mutation 'R2055:Arhgef25'
ID226607
Institutional Source Beutler Lab
Gene Symbol Arhgef25
Ensembl Gene ENSMUSG00000019467
Gene NameRho guanine nucleotide exchange factor (GEF) 25
SynonymsD10Ertd610e, 2410008H17Rik, GEFT
MMRRC Submission 040060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R2055 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127182525-127190083 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127185135 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 294 (N294I)
Ref Sequence ENSEMBL: ENSMUSP00000152503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000095270] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006] [ENSMUST00000222911]
Predicted Effect probably damaging
Transcript: ENSMUST00000019611
AA Change: N294I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467
AA Change: N294I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095270
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167353
AA Change: N285I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467
AA Change: N285I

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably damaging
Transcript: ENSMUST00000218654
AA Change: N255I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221174
Predicted Effect probably damaging
Transcript: ENSMUST00000222006
AA Change: N294I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222911
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases alternate between an inactive GDP-bound state and an active GTP-bound state, and GEFs facilitate GDP/GTP exchange. This gene encodes a guanine nucleotide exchange factor (GEF) which interacts with Rho GTPases involved in contraction of vascular smooth muscles, regulation of responses to angiotensin II and lens cell differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated in the second heart field exhibit normal cardiac development and prenatal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,845 E185G probably damaging Het
3425401B19Rik A G 14: 32,662,551 S486P probably benign Het
4931408C20Rik A T 1: 26,685,732 N122K possibly damaging Het
A630023A22Rik T C 14: 34,052,750 probably benign Het
Abca1 T C 4: 53,069,881 N1271S probably benign Het
AI597479 C T 1: 43,111,120 A130V probably benign Het
Angptl4 A G 17: 33,780,524 probably null Het
Atp2b1 T C 10: 99,014,559 V848A probably damaging Het
Bard1 T C 1: 71,074,872 T317A probably benign Het
C1rl T C 6: 124,493,822 W30R probably benign Het
Cchcr1 A G 17: 35,526,420 E379G probably damaging Het
Cfap36 G T 11: 29,247,122 A3E probably damaging Het
Cilp G A 9: 65,279,715 G1031S probably damaging Het
Clca4a A G 3: 144,970,728 Y64H probably damaging Het
Cops5 A G 1: 10,032,337 probably null Het
Cracr2a G T 6: 127,608,601 E121* probably null Het
Cstf1 A G 2: 172,380,483 E387G probably benign Het
D630044L22Rik A C 17: 25,961,977 D733E probably damaging Het
Dlc1 A T 8: 36,593,381 C514S probably damaging Het
Dmwd G T 7: 19,076,685 R139L probably benign Het
Dnah17 A T 11: 118,067,531 S2709T probably benign Het
Dnmt3a T C 12: 3,872,859 I154T probably benign Het
Dpp7 T C 2: 25,354,478 N297S possibly damaging Het
Ern2 A T 7: 122,183,945 V34D possibly damaging Het
Erp27 A G 6: 136,908,229 probably benign Het
F2 T C 2: 91,628,442 T508A probably benign Het
Fam181b A G 7: 93,080,426 T136A probably benign Het
Fam227b C A 2: 126,100,954 V308L probably benign Het
Fbxw20 A T 9: 109,221,374 H394Q probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Glt8d1 T G 14: 31,009,736 S111A probably benign Het
Gm11146 A T 16: 77,595,081 probably benign Het
Gm5724 A T 6: 141,725,455 H430Q probably benign Het
Grip1 C T 10: 120,049,511 probably benign Het
H2-Q2 A T 17: 35,345,271 T334S probably benign Het
Hcrtr1 A G 4: 130,130,887 V402A probably benign Het
Hmcn2 C A 2: 31,378,282 A1130D probably benign Het
Hsd17b2 T C 8: 117,702,174 L60P possibly damaging Het
Htr1f A T 16: 64,926,035 I298N probably damaging Het
Ighmbp2 G T 19: 3,265,095 A775D probably benign Het
Kcnn3 A G 3: 89,521,375 T303A probably damaging Het
Kiz C A 2: 146,891,283 Q460K probably benign Het
Krt75 C T 15: 101,572,761 V193I probably benign Het
Lsp1 G A 7: 142,489,407 probably null Het
Mfsd12 A G 10: 81,360,229 H146R probably damaging Het
Mmp23 T C 4: 155,651,987 K199R possibly damaging Het
Naip2 A G 13: 100,179,372 V300A probably benign Het
Nbeal1 C T 1: 60,311,057 L2422F probably damaging Het
Nbeal2 G T 9: 110,635,307 D1094E possibly damaging Het
Nckap5 T C 1: 126,026,898 E639G probably damaging Het
Nr4a3 A G 4: 48,067,771 I456V possibly damaging Het
Olfr224 A G 11: 58,566,847 F166S probably damaging Het
Parp9 G T 16: 35,953,614 V86L probably damaging Het
Phactr1 A G 13: 43,077,940 N386S probably damaging Het
Pold2 A T 11: 5,873,516 Y304* probably null Het
Pou5f2 A G 13: 78,025,821 Y294C probably benign Het
Rars A G 11: 35,826,583 probably benign Het
Rbm12b1 A G 4: 12,145,606 E526G probably benign Het
Sacs T C 14: 61,214,049 Y4515H probably damaging Het
Sdk2 C A 11: 113,850,954 R813L probably damaging Het
Six5 T C 7: 19,095,229 V198A possibly damaging Het
Spn A G 7: 127,137,216 S40P probably damaging Het
Ssr1 A G 13: 37,987,785 probably benign Het
Tlr6 C A 5: 64,953,926 C546F probably damaging Het
Top1 T A 2: 160,702,828 probably benign Het
Trhr2 A G 8: 122,358,793 S151P probably damaging Het
Tubb2b T G 13: 34,127,725 K362Q probably benign Het
Unc13c T C 9: 73,736,550 T1211A probably damaging Het
Vmn1r15 T C 6: 57,258,744 V199A possibly damaging Het
Vnn1 A G 10: 23,900,577 probably benign Het
Vps41 T A 13: 18,854,616 N737K possibly damaging Het
Vps50 T A 6: 3,522,265 N144K probably benign Het
Zc3h7a A T 16: 11,137,476 N911K probably benign Het
Zkscan7 T A 9: 122,888,937 S132R probably damaging Het
Other mutations in Arhgef25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgef25 APN 10 127184170 missense probably damaging 1.00
IGL02499:Arhgef25 APN 10 127185591 missense probably damaging 1.00
IGL03276:Arhgef25 APN 10 127185925 missense possibly damaging 0.78
R0021:Arhgef25 UTSW 10 127189554 missense probably benign 0.00
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0038:Arhgef25 UTSW 10 127186865 splice site probably benign
R0106:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0242:Arhgef25 UTSW 10 127184064 missense probably damaging 1.00
R0358:Arhgef25 UTSW 10 127184453 missense probably damaging 1.00
R0505:Arhgef25 UTSW 10 127183697 missense probably null 0.03
R0676:Arhgef25 UTSW 10 127184010 critical splice donor site probably null
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1185:Arhgef25 UTSW 10 127183781 missense possibly damaging 0.85
R1600:Arhgef25 UTSW 10 127185289 missense probably damaging 0.99
R1846:Arhgef25 UTSW 10 127185864 missense probably damaging 1.00
R2254:Arhgef25 UTSW 10 127189521 missense probably benign 0.01
R2496:Arhgef25 UTSW 10 127187194 missense probably benign 0.08
R3836:Arhgef25 UTSW 10 127189736 missense probably benign
R3837:Arhgef25 UTSW 10 127189736 missense probably benign
R3838:Arhgef25 UTSW 10 127189736 missense probably benign
R3839:Arhgef25 UTSW 10 127189736 missense probably benign
R3950:Arhgef25 UTSW 10 127185144 missense probably damaging 1.00
R3980:Arhgef25 UTSW 10 127187220 missense probably damaging 1.00
R4883:Arhgef25 UTSW 10 127182933 missense probably benign 0.43
R4964:Arhgef25 UTSW 10 127185603 missense probably damaging 1.00
R5192:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5196:Arhgef25 UTSW 10 127185109 missense probably damaging 1.00
R5420:Arhgef25 UTSW 10 127187274 missense probably benign 0.37
R6301:Arhgef25 UTSW 10 127185882 missense possibly damaging 0.88
R6764:Arhgef25 UTSW 10 127184101 missense probably damaging 1.00
R7096:Arhgef25 UTSW 10 127184028 missense probably damaging 1.00
R7289:Arhgef25 UTSW 10 127183772 missense possibly damaging 0.92
R7482:Arhgef25 UTSW 10 127185671 missense probably damaging 1.00
X0018:Arhgef25 UTSW 10 127183699 missense probably damaging 1.00
X0024:Arhgef25 UTSW 10 127183257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATTGAGCTGCAGTCG -3'
(R):5'- GCAGTGTTTGAAAGATCCCGATTG -3'

Sequencing Primer
(F):5'- CATTGAGCTGCAGTCGGTGTC -3'
(R):5'- GGTTGGCTCAGCTGTTCATCAAAC -3'
Posted On2014-09-17