Incidental Mutation 'R2066:Tpp2'
ID226638
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission 040071-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R2066 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 43978438 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 734 (I734S)
Ref Sequence ENSEMBL: ENSMUSP00000139918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388] [ENSMUST00000190207]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087933
AA Change: I734S

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: I734S

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186441
Predicted Effect probably benign
Transcript: ENSMUST00000188302
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188313
AA Change: I734S

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: I734S

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189388
AA Change: I734S

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: I734S

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190207
SMART Domains Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
low complexity region 70 86 N/A INTRINSIC
PDB:3LXU|X 87 281 3e-19 PDB
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
9530002B09Rik T A 4: 122,689,322 probably benign Het
Acadl C T 1: 66,841,746 probably null Het
Acss1 G A 2: 150,668,131 Q23* probably null Het
Afap1l1 A T 18: 61,739,122 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ano5 T G 7: 51,585,386 L639R probably damaging Het
Arhgap26 T C 18: 39,306,728 S71P probably damaging Het
B3gnt2 A G 11: 22,836,735 L151P probably damaging Het
Bach1 A T 16: 87,729,625 K658N probably damaging Het
Bdnf C A 2: 109,723,902 T207K probably damaging Het
Bod1l G T 5: 41,805,156 T2746K probably damaging Het
Brwd1 A G 16: 96,046,465 S652P probably benign Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Clasp2 T A 9: 113,906,157 I1021N possibly damaging Het
Cnep1r1 G T 8: 88,118,817 probably benign Het
Cntn6 C T 6: 104,861,822 R946* probably null Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnajc13 A T 9: 104,221,441 I471N probably benign Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Emx2 A G 19: 59,461,698 N149S probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Filip1 A G 9: 79,820,216 S374P probably damaging Het
Fry T A 5: 150,370,119 probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm2959 A G 14: 42,413,701 noncoding transcript Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Hdlbp A G 1: 93,421,880 probably benign Het
Hunk G A 16: 90,481,245 probably null Het
Ifnb1 T A 4: 88,522,759 I6F possibly damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Ints1 A G 5: 139,767,496 V720A probably benign Het
Invs T A 4: 48,396,287 L320Q probably damaging Het
Jpt2 G A 17: 24,948,739 Q79* probably null Het
Lingo2 A G 4: 35,709,179 L267P probably benign Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Meiob G T 17: 24,818,316 R56L probably damaging Het
Mindy3 A T 2: 12,419,249 S2T probably damaging Het
Mrm3 A T 11: 76,250,321 D385V probably damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Nbea A G 3: 55,968,146 V1701A probably damaging Het
Nipal4 T G 11: 46,156,795 D104A probably damaging Het
Npas4 A G 19: 4,987,414 V284A probably damaging Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Obscn G A 11: 59,135,732 A215V possibly damaging Het
Olfr1218 A G 2: 89,054,899 Y176H probably damaging Het
Olfr870 G T 9: 20,171,554 Q6K probably benign Het
Olfr938 T C 9: 39,078,214 Y177C probably damaging Het
Pgs1 G A 11: 118,014,570 probably benign Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Phldb2 A T 16: 45,770,758 L970Q probably damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Ppip5k1 A G 2: 121,342,871 probably benign Het
Prune2 A G 19: 17,120,678 D1182G possibly damaging Het
Psg25 G A 7: 18,529,562 T112I probably damaging Het
Sec61g T C 11: 16,508,124 T24A probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Sorbs1 T C 19: 40,365,028 probably null Het
Sox2 C A 3: 34,651,307 Q298K possibly damaging Het
Spatc1 T A 15: 76,283,537 probably null Het
Szt2 T C 4: 118,373,980 M2529V unknown Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ttc28 C A 5: 111,225,933 F1078L probably benign Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Zdhhc13 T A 7: 48,816,427 V284D probably benign Het
Zfp668 C A 7: 127,867,031 R327L probably damaging Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
eddie UTSW 1 43968988 missense probably damaging 1.00
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1593:Tpp2 UTSW 1 43975433 missense probably benign 0.01
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
R7324:Tpp2 UTSW 1 43978778 missense probably damaging 1.00
R7363:Tpp2 UTSW 1 43985422 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGTACAACAGAGCTTAGGATAC -3'
(R):5'- TCCTTCAGATGCATGCTACAAAAC -3'

Sequencing Primer
(F):5'- AATTATGTTTAAATTGGGTCCTAGGG -3'
(R):5'- ATGCAAGTTTTCAATATCCATGAATG -3'
Posted On2014-09-17