Incidental Mutation 'R2067:Sall4'
ID226733
Institutional Source Beutler Lab
Gene Symbol Sall4
Ensembl Gene ENSMUSG00000027547
Gene Namespalt like transcription factor 4
Synonyms5730441M18Rik, Tex20, C330011P20Rik
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2067 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168748332-168767943 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 168756545 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 125 (N125S)
Ref Sequence ENSEMBL: ENSMUSP00000099363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029061] [ENSMUST00000075044] [ENSMUST00000103074] [ENSMUST00000137536] [ENSMUST00000150588]
Predicted Effect probably benign
Transcript: ENSMUST00000029061
AA Change: N125S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029061
Gene: ENSMUSG00000027547
AA Change: N125S

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
ZnF_C2H2 387 409 1.04e-3 SMART
ZnF_C2H2 415 437 2.15e-5 SMART
ZnF_C2H2 573 595 5.34e0 SMART
ZnF_C2H2 601 623 1.22e-4 SMART
ZnF_C2H2 633 655 1.84e-4 SMART
low complexity region 855 867 N/A INTRINSIC
ZnF_C2H2 880 902 2.53e-2 SMART
ZnF_C2H2 908 930 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075044
SMART Domains Protein: ENSMUSP00000074556
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 30 38 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
ZnF_C2H2 91 113 2.53e-2 SMART
ZnF_C2H2 119 141 1.13e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103074
AA Change: N125S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099363
Gene: ENSMUSG00000027547
AA Change: N125S

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
ZnF_C2H2 68 88 1.31e2 SMART
low complexity region 193 203 N/A INTRINSIC
low complexity region 210 230 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
low complexity region 295 313 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 436 458 2.53e-2 SMART
ZnF_C2H2 464 486 1.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130640
Predicted Effect probably benign
Transcript: ENSMUST00000137536
AA Change: N94S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115646
Gene: ENSMUSG00000027547
AA Change: N94S

DomainStartEndE-ValueType
Blast:ZnF_C2H2 37 61 6e-9 BLAST
low complexity region 162 172 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150588
SMART Domains Protein: ENSMUSP00000119628
Gene: ENSMUSG00000027547

DomainStartEndE-ValueType
ZnF_C2H2 64 86 1.22e-4 SMART
ZnF_C2H2 96 118 1.84e-4 SMART
Meta Mutation Damage Score 0.0408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene belongs to the spalt family of zinc finger transcription factors. In mouse, functions for this gene have been described in many embryonic developmental processes, including brain, heart, and limb development. In addition, this gene is an important pluripotency factor that is required for stem cell maintenance. Homozygous mutant mice display embryonic lethality, while conditional knock-out in embryonic germ cells results in failure to establish a robust stem cell population. A pseudogene of this gene is found on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in early embryonic lethality before somite formation. Heterozygous mutation of this locus causes variable phenotypes, from heart and digit defects to deafness, anogenital tract defects, cranial and carpal bone defects and renal agenesis or hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Sall4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Sall4 APN 2 168755312 missense probably benign 0.02
IGL00592:Sall4 APN 2 168755963 missense probably damaging 1.00
IGL00674:Sall4 APN 2 168755780 missense probably damaging 0.99
IGL01308:Sall4 APN 2 168750244 missense probably damaging 0.99
IGL01538:Sall4 APN 2 168755856 missense probably damaging 1.00
IGL01552:Sall4 APN 2 168756123 missense probably damaging 1.00
IGL02614:Sall4 APN 2 168755885 missense probably null 0.79
R0514:Sall4 UTSW 2 168755705 missense probably damaging 1.00
R0531:Sall4 UTSW 2 168756336 missense probably benign 0.10
R0747:Sall4 UTSW 2 168754966 missense probably damaging 1.00
R1371:Sall4 UTSW 2 168756474 missense probably benign 0.10
R1736:Sall4 UTSW 2 168752635 missense probably benign 0.10
R3766:Sall4 UTSW 2 168756044 missense possibly damaging 0.93
R3783:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3784:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3785:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3787:Sall4 UTSW 2 168756123 missense probably damaging 1.00
R3877:Sall4 UTSW 2 168756242 missense probably damaging 1.00
R4356:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4358:Sall4 UTSW 2 168755480 missense probably benign 0.37
R4760:Sall4 UTSW 2 168750427 missense probably damaging 0.98
R4869:Sall4 UTSW 2 168755717 missense probably damaging 1.00
R5979:Sall4 UTSW 2 168750343 missense probably benign 0.28
R6089:Sall4 UTSW 2 168755486 missense possibly damaging 0.92
R6502:Sall4 UTSW 2 168755708 missense probably damaging 1.00
R6990:Sall4 UTSW 2 168755070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCGAATCTGTTCCGTAAGC -3'
(R):5'- GGAGGACACTCACATCTGCAAC -3'

Sequencing Primer
(F):5'- GATCTGCTCCAGGACCCAAG -3'
(R):5'- ACAAATGCTGTGCCGAGTTC -3'
Posted On2014-09-17