Incidental Mutation 'R2067:Espl1'
ID226795
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2067 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102299090 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 330 (S330P)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: S330P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: S330P

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: S330P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229580
Predicted Effect probably benign
Transcript: ENSMUST00000230212
Predicted Effect probably benign
Transcript: ENSMUST00000231104
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGAGAGGGCTCGTAATC -3'
(R):5'- AGCCTAGAGAGCAGCTTACCAAG -3'

Sequencing Primer
(F):5'- AGGGCTCGTAATCACCTAGAG -3'
(R):5'- GCTTACCAAGGCTCCAGAATTTC -3'
Posted On2014-09-17