Incidental Mutation 'R2068:Thbs1'
ID226814
Institutional Source Beutler Lab
Gene Symbol Thbs1
Ensembl Gene ENSMUSG00000040152
Gene Namethrombospondin 1
SynonymsTSP-1, TSP1, tbsp1, Thbs-1
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118111876-118127133 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 118123537 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1090 (Q1090*)
Ref Sequence ENSEMBL: ENSMUSP00000044903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039559]
Predicted Effect probably null
Transcript: ENSMUST00000039559
AA Change: Q1090*
SMART Domains Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: Q1090*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TSPN 24 221 2.68e-60 SMART
low complexity region 237 249 N/A INTRINSIC
coiled coil region 292 315 N/A INTRINSIC
VWC 319 373 3.6e-20 SMART
TSP1 383 430 4.21e-12 SMART
TSP1 439 491 3.04e-18 SMART
TSP1 496 548 8.6e-18 SMART
EGF 551 588 3.88e-3 SMART
EGF 592 646 1.69e1 SMART
EGF 650 691 7.13e-2 SMART
Pfam:TSP_3 728 763 5.8e-12 PFAM
Pfam:TSP_3 763 786 2.1e-5 PFAM
Pfam:TSP_3 787 822 3.3e-13 PFAM
Pfam:TSP_3 822 845 1.1e-6 PFAM
Pfam:TSP_3 846 883 2e-15 PFAM
Pfam:TSP_3 884 919 8.3e-13 PFAM
Pfam:TSP_3 920 954 4.9e-10 PFAM
Pfam:TSP_C 973 1170 1.4e-99 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190311
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Thbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Thbs1 APN 2 118122973 missense probably damaging 1.00
IGL00920:Thbs1 APN 2 118113201 missense probably damaging 0.99
IGL01295:Thbs1 APN 2 118118327 missense possibly damaging 0.88
IGL01649:Thbs1 APN 2 118114982 missense probably benign
IGL02077:Thbs1 APN 2 118113110 missense probably benign 0.00
IGL02251:Thbs1 APN 2 118113518 missense probably benign 0.00
IGL02263:Thbs1 APN 2 118119880 missense probably benign 0.06
IGL02392:Thbs1 APN 2 118114660 missense probably benign
IGL02393:Thbs1 APN 2 118123099 missense possibly damaging 0.87
IGL02411:Thbs1 APN 2 118114970 missense probably benign
IGL02659:Thbs1 APN 2 118114792 missense probably benign 0.29
Stark UTSW 2 118121237 critical splice donor site probably null
R0014:Thbs1 UTSW 2 118113350 missense possibly damaging 0.51
R0042:Thbs1 UTSW 2 118122877 missense probably damaging 1.00
R0064:Thbs1 UTSW 2 118123914 critical splice acceptor site probably null
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0240:Thbs1 UTSW 2 118114393 missense probably damaging 1.00
R0316:Thbs1 UTSW 2 118117574 missense probably damaging 1.00
R0393:Thbs1 UTSW 2 118112991 missense possibly damaging 0.69
R0678:Thbs1 UTSW 2 118122906 missense probably damaging 1.00
R1037:Thbs1 UTSW 2 118123051 missense probably damaging 1.00
R1440:Thbs1 UTSW 2 118114355 missense probably damaging 1.00
R1454:Thbs1 UTSW 2 118122672 missense probably damaging 1.00
R1571:Thbs1 UTSW 2 118119197 missense probably damaging 0.99
R1702:Thbs1 UTSW 2 118113442 missense probably benign
R2035:Thbs1 UTSW 2 118118340 critical splice donor site probably null
R2171:Thbs1 UTSW 2 118122579 missense probably damaging 1.00
R2844:Thbs1 UTSW 2 118117628 missense probably benign 0.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R2870:Thbs1 UTSW 2 118119378 missense probably damaging 1.00
R3620:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3621:Thbs1 UTSW 2 118121159 missense probably benign 0.05
R3726:Thbs1 UTSW 2 118114710 missense probably benign 0.02
R4499:Thbs1 UTSW 2 118119950 missense possibly damaging 0.82
R4524:Thbs1 UTSW 2 118122979 missense probably damaging 1.00
R4576:Thbs1 UTSW 2 118119416 missense probably damaging 0.97
R4596:Thbs1 UTSW 2 118114755 missense possibly damaging 0.80
R4646:Thbs1 UTSW 2 118118329 missense probably benign 0.15
R4783:Thbs1 UTSW 2 118114792 missense probably benign 0.04
R4836:Thbs1 UTSW 2 118115018 missense possibly damaging 0.91
R4943:Thbs1 UTSW 2 118113449 missense probably damaging 1.00
R4967:Thbs1 UTSW 2 118114778 missense probably benign
R5014:Thbs1 UTSW 2 118120037 critical splice donor site probably null
R5062:Thbs1 UTSW 2 118121237 critical splice donor site probably null
R5363:Thbs1 UTSW 2 118122666 missense probably damaging 1.00
R5420:Thbs1 UTSW 2 118113155 missense possibly damaging 0.83
R5432:Thbs1 UTSW 2 118114683 missense probably benign 0.25
R5788:Thbs1 UTSW 2 118122508 missense probably damaging 1.00
R6221:Thbs1 UTSW 2 118119997 missense probably damaging 1.00
R6327:Thbs1 UTSW 2 118112656 missense unknown
R6466:Thbs1 UTSW 2 118119847 missense probably damaging 1.00
R6480:Thbs1 UTSW 2 118119117 missense probably damaging 1.00
R6794:Thbs1 UTSW 2 118120038 splice site probably null
R6983:Thbs1 UTSW 2 118119952 missense probably damaging 1.00
X0019:Thbs1 UTSW 2 118112982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCGGCTACCAGTCCAGC -3'
(R):5'- TGTTTGAAGTGACTGAAGCTGCC -3'

Sequencing Primer
(F):5'- CAGCCGCTTCTACGTTGTGATG -3'
(R):5'- AGCTGCCTGTGCACTTAAAG -3'
Posted On2014-09-17