Incidental Mutation 'R2068:Htt'
ID226821
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34825982 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 975 (T975I)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: T975I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: T975I

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148953
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4684:Htt UTSW 5 34852765 missense probably damaging 1.00
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5566:Htt UTSW 5 34849075 missense probably damaging 1.00
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6169:Htt UTSW 5 34907473 missense probably damaging 1.00
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7166:Htt UTSW 5 34852894 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CAGCAGCACACGGTAATGAG -3'
(R):5'- GTGCTACTTTGGAATCTGTTGAAAG -3'

Sequencing Primer
(F):5'- GGAAAGACCTTTTGCATGCTAAGC -3'
(R):5'- TGGAATCTGTTGAAAGAACTACAC -3'
Posted On2014-09-17