Incidental Mutation 'R2068:Rgma'
ID226838
Institutional Source Beutler Lab
Gene Symbol Rgma
Ensembl Gene ENSMUSG00000070509
Gene Namerepulsive guidance molecule family member A
SynonymsRGM domain family, member A
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.371) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location73375509-73419899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73409631 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 161 (D161A)
Ref Sequence ENSEMBL: ENSMUSP00000145758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094312] [ENSMUST00000119206] [ENSMUST00000128471] [ENSMUST00000139780]
Predicted Effect probably damaging
Transcript: ENSMUST00000094312
AA Change: D177A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091870
Gene: ENSMUSG00000070509
AA Change: D177A

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:RGM_N 48 223 6.6e-74 PFAM
Pfam:RGM_C 227 410 1.5e-75 PFAM
low complexity region 422 430 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119206
AA Change: D67A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112599
Gene: ENSMUSG00000070509
AA Change: D67A

DomainStartEndE-ValueType
Pfam:RGM_N 1 113 3.8e-45 PFAM
Pfam:RGM_C 117 302 1.8e-76 PFAM
low complexity region 312 320 N/A INTRINSIC
low complexity region 329 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128471
SMART Domains Protein: ENSMUSP00000116552
Gene: ENSMUSG00000070509

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:RGM_N 32 101 7.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139780
AA Change: D161A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206096
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the repulsive guidance molecule family. The encoded protein is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. This protein may also function as a tumor suppressor in some cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Inactivation of this locus results in impaired cephalic closure and subsequent exencephaly, both with incomplete penetrance. The retinal topography of the visual system is normal in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Rgma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Rgma APN 7 73417491 missense probably damaging 1.00
IGL01089:Rgma APN 7 73409714 missense possibly damaging 0.79
IGL01336:Rgma APN 7 73409318 missense possibly damaging 0.61
IGL01339:Rgma APN 7 73417483 missense probably damaging 1.00
IGL01340:Rgma APN 7 73417330 missense probably damaging 1.00
IGL02034:Rgma APN 7 73417433 missense probably damaging 0.99
IGL03003:Rgma APN 7 73417440 missense probably damaging 0.97
IGL03050:Rgma UTSW 7 73417515 missense probably damaging 1.00
R0173:Rgma UTSW 7 73417554 missense probably damaging 1.00
R0630:Rgma UTSW 7 73417618 missense probably damaging 1.00
R0691:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0696:Rgma UTSW 7 73409412 missense probably damaging 0.99
R0971:Rgma UTSW 7 73391498 critical splice donor site probably null
R1394:Rgma UTSW 7 73417794 missense probably benign 0.06
R1395:Rgma UTSW 7 73417794 missense probably benign 0.06
R1707:Rgma UTSW 7 73417959 missense unknown
R1731:Rgma UTSW 7 73409412 missense probably damaging 0.99
R1792:Rgma UTSW 7 73417837 missense probably damaging 0.97
R2327:Rgma UTSW 7 73417826 missense probably damaging 1.00
R4707:Rgma UTSW 7 73417816 missense probably damaging 1.00
R5976:Rgma UTSW 7 73409468 missense probably damaging 0.97
R6458:Rgma UTSW 7 73409694 missense probably damaging 1.00
R6702:Rgma UTSW 7 73417320 missense probably damaging 1.00
R7123:Rgma UTSW 7 73409391 missense probably damaging 1.00
V7732:Rgma UTSW 7 73417320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCACTCGGCTGTCCATG -3'
(R):5'- AGGTGCCTGCATAGTGTGAC -3'

Sequencing Primer
(F):5'- TCCATGGCATAGAGGACCTTATG -3'
(R):5'- TGCATAGTGTGACCCTGCAG -3'
Posted On2014-09-17