Incidental Mutation 'R2068:Trmt5'
ID226867
Institutional Source Beutler Lab
Gene Symbol Trmt5
Ensembl Gene ENSMUSG00000034442
Gene NameTRM5 tRNA methyltransferase 5
Synonyms2610027O18Rik
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.975) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location73280011-73286710 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 73284670 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058139] [ENSMUST00000101313] [ENSMUST00000116420] [ENSMUST00000122920] [ENSMUST00000126488] [ENSMUST00000140523] [ENSMUST00000153941] [ENSMUST00000220701] [ENSMUST00000221189]
Predicted Effect probably benign
Transcript: ENSMUST00000058139
SMART Domains Protein: ENSMUSP00000057153
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101313
SMART Domains Protein: ENSMUSP00000098871
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 1 69 4.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116420
AA Change: L204H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112121
Gene: ENSMUSG00000034442
AA Change: L204H

DomainStartEndE-ValueType
Pfam:Met_10 191 412 4.5e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000122920
SMART Domains Protein: ENSMUSP00000124386
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 113 3.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000126488
SMART Domains Protein: ENSMUSP00000118374
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 122 9.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140523
SMART Domains Protein: ENSMUSP00000120810
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 452 2.5e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153941
SMART Domains Protein: ENSMUSP00000114870
Gene: ENSMUSG00000044712

DomainStartEndE-ValueType
Pfam:Aa_trans 44 124 1.6e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220701
Predicted Effect probably benign
Transcript: ENSMUST00000221189
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] tRNAs contain as many as 13 or 14 nucleotides that are modified posttranscriptionally by enzymes that are highly specific for particular nucleotides in the tRNA structure. TRMT5 methylates the N1 position of guanosine-37 (G37) in selected tRNAs using S-adenosyl methionine (Brule et al., 2004 [PubMed 15248782]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Trmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Trmt5 APN 12 73284919 missense possibly damaging 0.80
IGL01468:Trmt5 APN 12 73281104 missense probably benign 0.08
IGL01681:Trmt5 APN 12 73282603 unclassified probably benign
IGL02502:Trmt5 APN 12 73281227 missense probably benign 0.06
IGL02627:Trmt5 APN 12 73281455 missense probably damaging 1.00
IGL02688:Trmt5 APN 12 73281458 nonsense probably null
IGL03390:Trmt5 APN 12 73282727 missense probably benign 0.30
IGL03391:Trmt5 APN 12 73281452 missense probably benign 0.00
R2239:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R2380:Trmt5 UTSW 12 73285114 missense probably benign 0.00
R5169:Trmt5 UTSW 12 73282721 missense probably damaging 1.00
R5578:Trmt5 UTSW 12 73285063 unclassified probably null
R5579:Trmt5 UTSW 12 73281652 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAGGCCCAAAAGTCTCTGCC -3'
(R):5'- CCTTTGACAAAGCAGAACTCGG -3'

Sequencing Primer
(F):5'- TTTTCAAAAAGGGGGAAGGTGCTTC -3'
(R):5'- GCAGAACTCGGAGTTTTAAAAGAAC -3'
Posted On2014-09-17