Incidental Mutation 'R2068:Pcdh8'
ID226882
Institutional Source Beutler Lab
Gene Symbol Pcdh8
Ensembl Gene ENSMUSG00000036422
Gene Nameprotocadherin 8
Synonyms1700080P15Rik, Papc
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location79766775-79771312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79768211 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 912 (S912R)
Ref Sequence ENSEMBL: ENSMUSP00000045333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]
Predicted Effect probably damaging
Transcript: ENSMUST00000039568
AA Change: S912R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: S912R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 782 802 N/A INTRINSIC
low complexity region 828 860 N/A INTRINSIC
low complexity region 910 933 N/A INTRINSIC
low complexity region 974 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195034
Predicted Effect probably damaging
Transcript: ENSMUST00000195355
AA Change: S815R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: S815R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CA 45 133 8.69e-2 SMART
CA 157 243 1.22e-14 SMART
CA 268 352 6.08e-24 SMART
low complexity region 360 392 N/A INTRINSIC
CA 414 495 5.34e-20 SMART
CA 519 607 1.57e-26 SMART
CA 636 718 1.12e-4 SMART
transmembrane domain 748 770 N/A INTRINSIC
low complexity region 813 836 N/A INTRINSIC
low complexity region 877 883 N/A INTRINSIC
Meta Mutation Damage Score 0.0396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Pcdh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pcdh8 APN 14 79769246 missense probably damaging 0.99
IGL02611:Pcdh8 APN 14 79767667 missense probably benign 0.00
R0094:Pcdh8 UTSW 14 79768148 missense probably damaging 1.00
R0118:Pcdh8 UTSW 14 79767408 missense probably damaging 1.00
R0558:Pcdh8 UTSW 14 79770076 missense probably damaging 1.00
R0681:Pcdh8 UTSW 14 79769960 missense probably benign
R0718:Pcdh8 UTSW 14 79770691 missense possibly damaging 0.49
R1281:Pcdh8 UTSW 14 79767726 missense probably damaging 1.00
R1487:Pcdh8 UTSW 14 79769547 missense probably damaging 1.00
R1511:Pcdh8 UTSW 14 79769389 missense possibly damaging 0.46
R1552:Pcdh8 UTSW 14 79770607 missense probably benign 0.20
R1556:Pcdh8 UTSW 14 79770403 missense probably damaging 1.00
R1659:Pcdh8 UTSW 14 79768134 missense probably damaging 1.00
R2062:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2063:Pcdh8 UTSW 14 79768211 missense probably damaging 1.00
R2920:Pcdh8 UTSW 14 79768714 missense possibly damaging 0.88
R3970:Pcdh8 UTSW 14 79770266 missense possibly damaging 0.78
R4113:Pcdh8 UTSW 14 79767513 missense probably damaging 1.00
R4771:Pcdh8 UTSW 14 79768270 missense possibly damaging 0.48
R4840:Pcdh8 UTSW 14 79770868 missense possibly damaging 0.67
R5169:Pcdh8 UTSW 14 79767655 missense probably benign 0.09
R5187:Pcdh8 UTSW 14 79770154 missense probably damaging 0.99
R5415:Pcdh8 UTSW 14 79770248 nonsense probably null
R5548:Pcdh8 UTSW 14 79767502 missense probably damaging 1.00
R5749:Pcdh8 UTSW 14 79770085 missense probably damaging 1.00
R5778:Pcdh8 UTSW 14 79770757 missense probably damaging 1.00
R5795:Pcdh8 UTSW 14 79770980 missense possibly damaging 0.95
R6313:Pcdh8 UTSW 14 79767651 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTAAAGGGAATGGGGTCCG -3'
(R):5'- ATGTTTAACCTGTCGCACTTGC -3'

Sequencing Primer
(F):5'- TGGGAACAGAGGTTTTGAGC -3'
(R):5'- ATTCCCTGCTGCAGCCTTACG -3'
Posted On2014-09-17