Incidental Mutation 'R2068:Ccnt1'
ID226887
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Namecyclin T1
Synonyms2810478G24Rik, CycT1
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R2068 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98538689-98570923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98551942 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 156 (H156Q)
Ref Sequence ENSEMBL: ENSMUSP00000126874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000168928] [ENSMUST00000169707]
Predicted Effect probably benign
Transcript: ENSMUST00000012104
AA Change: H156Q

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960
AA Change: H156Q

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164565
Predicted Effect probably benign
Transcript: ENSMUST00000168928
AA Change: H156Q

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960
AA Change: H156Q

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169674
Predicted Effect probably benign
Transcript: ENSMUST00000169707
AA Change: H156Q

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960
AA Change: H156Q

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170452
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98565109 missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98554633 missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98544241 missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98567603 missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98546783 missense possibly damaging 0.92
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98544338 missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98543600 missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98544059 missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98544308 missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98543451 missense probably damaging 1.00
R4836:Ccnt1 UTSW 15 98567563 missense probably damaging 0.96
R5320:Ccnt1 UTSW 15 98544243 missense probably benign 0.35
R5740:Ccnt1 UTSW 15 98544500 missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98543513 nonsense probably null
R6074:Ccnt1 UTSW 15 98543324 missense probably damaging 1.00
R6413:Ccnt1 UTSW 15 98543969 missense probably benign 0.01
R6610:Ccnt1 UTSW 15 98565101 missense probably damaging 1.00
R7260:Ccnt1 UTSW 15 98565124 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTTGTGAAGTACCCCAACC -3'
(R):5'- AGTCACTTAGTCTCTGCACAG -3'

Sequencing Primer
(F):5'- TGTATGGCTCACAGTCCAAG -3'
(R):5'- CTGGCCATTAATAATTCAGACA -3'
Posted On2014-09-17