Incidental Mutation 'R2068:Itpr3'
ID226891
Institutional Source Beutler Lab
Gene Symbol Itpr3
Ensembl Gene ENSMUSG00000042644
Gene Nameinositol 1,4,5-triphosphate receptor 3
Synonymstf, Ip3r3, Itpr-3
MMRRC Submission 040073-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2068 (G1)
Quality Score154
Status Not validated
Chromosome17
Chromosomal Location27057304-27122223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27098076 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 768 (M768I)
Ref Sequence ENSEMBL: ENSMUSP00000038150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049308]
PDB Structure
Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049308
AA Change: M768I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: M768I

DomainStartEndE-ValueType
MIR 113 167 7.75e-6 SMART
MIR 174 224 1.16e-4 SMART
MIR 232 288 1.21e-7 SMART
MIR 295 402 9.38e-14 SMART
Pfam:RYDR_ITPR 473 670 7.8e-64 PFAM
low complexity region 881 889 N/A INTRINSIC
Pfam:RYDR_ITPR 1175 1333 5.8e-16 PFAM
low complexity region 1549 1567 N/A INTRINSIC
low complexity region 1831 1851 N/A INTRINSIC
Pfam:RIH_assoc 1863 1973 2.6e-34 PFAM
transmembrane domain 2203 2225 N/A INTRINSIC
Pfam:Ion_trans 2235 2527 8.1e-20 PFAM
coiled coil region 2631 2660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143605
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Heg1 A G 16: 33,727,590 T916A probably benign Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Itpr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Itpr3 APN 17 27083629 missense probably benign 0.05
IGL00980:Itpr3 APN 17 27110956 missense probably benign
IGL01151:Itpr3 APN 17 27091529 missense probably damaging 1.00
IGL01289:Itpr3 APN 17 27099765 missense probably damaging 0.99
IGL01403:Itpr3 APN 17 27118595 missense probably damaging 0.97
IGL01666:Itpr3 APN 17 27117178 missense probably benign 0.02
IGL01897:Itpr3 APN 17 27111262 missense probably damaging 1.00
IGL02003:Itpr3 APN 17 27121475 missense probably damaging 1.00
IGL02012:Itpr3 APN 17 27104095 missense probably benign
IGL02063:Itpr3 APN 17 27120023 missense probably benign 0.01
IGL02146:Itpr3 APN 17 27117275 missense probably damaging 1.00
IGL02158:Itpr3 APN 17 27098442 missense probably damaging 1.00
IGL02177:Itpr3 APN 17 27099614 missense possibly damaging 0.74
IGL02247:Itpr3 APN 17 27098179 missense probably damaging 1.00
IGL02606:Itpr3 APN 17 27114512 splice site probably benign
IGL02651:Itpr3 APN 17 27106398 missense probably damaging 0.99
IGL02902:Itpr3 APN 17 27104556 missense probably benign 0.21
IGL03001:Itpr3 APN 17 27089612 splice site probably benign
IGL03004:Itpr3 APN 17 27097978 missense possibly damaging 0.90
IGL03065:Itpr3 APN 17 27091933 missense probably damaging 1.00
IGL03117:Itpr3 APN 17 27119266 missense probably damaging 1.00
IGL03181:Itpr3 APN 17 27111268 missense probably benign
IGL03404:Itpr3 APN 17 27091518 missense probably damaging 1.00
alopecia UTSW 17 27095478 missense probably damaging 0.98
beauty UTSW 17 27106342 missense probably damaging 1.00
Opuesto UTSW 17 27087592 missense probably damaging 1.00
paradox UTSW 17 27098171 missense probably damaging 1.00
pulchritude UTSW 17 27086960 missense probably damaging 0.97
R0010:Itpr3 UTSW 17 27120977 missense probably damaging 1.00
R0055:Itpr3 UTSW 17 27098322 missense probably damaging 1.00
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0068:Itpr3 UTSW 17 27104060 splice site probably benign
R0104:Itpr3 UTSW 17 27095992 missense probably benign 0.01
R0195:Itpr3 UTSW 17 27114114 missense probably damaging 1.00
R0212:Itpr3 UTSW 17 27089319 missense probably damaging 1.00
R0454:Itpr3 UTSW 17 27113819 missense probably benign
R0485:Itpr3 UTSW 17 27111929 missense probably damaging 0.98
R0501:Itpr3 UTSW 17 27107289 missense probably benign 0.09
R0781:Itpr3 UTSW 17 27110555 missense probably benign 0.00
R0890:Itpr3 UTSW 17 27089011 nonsense probably null
R1028:Itpr3 UTSW 17 27091369 missense probably benign 0.04
R1144:Itpr3 UTSW 17 27114923 missense probably benign 0.01
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1347:Itpr3 UTSW 17 27111561 missense probably benign 0.02
R1458:Itpr3 UTSW 17 27118372 missense probably benign 0.01
R1463:Itpr3 UTSW 17 27117154 splice site probably benign
R1472:Itpr3 UTSW 17 27114225 missense probably benign 0.09
R1529:Itpr3 UTSW 17 27105485 splice site probably null
R1533:Itpr3 UTSW 17 27095560 missense possibly damaging 0.71
R1537:Itpr3 UTSW 17 27114147 missense possibly damaging 0.96
R1618:Itpr3 UTSW 17 27116607 critical splice acceptor site probably null
R1672:Itpr3 UTSW 17 27089013 missense probably benign
R1726:Itpr3 UTSW 17 27111690 missense probably damaging 0.96
R1865:Itpr3 UTSW 17 27120023 missense probably benign 0.01
R1940:Itpr3 UTSW 17 27111217 missense probably damaging 1.00
R2023:Itpr3 UTSW 17 27102811 missense possibly damaging 0.76
R2063:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2064:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2065:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2067:Itpr3 UTSW 17 27098076 missense probably benign 0.19
R2219:Itpr3 UTSW 17 27115053 missense probably benign
R2248:Itpr3 UTSW 17 27115059 missense probably damaging 1.00
R2291:Itpr3 UTSW 17 27113579 missense possibly damaging 0.92
R2320:Itpr3 UTSW 17 27095915 missense probably benign
R2864:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R2865:Itpr3 UTSW 17 27091551 missense probably benign 0.01
R3778:Itpr3 UTSW 17 27095472 missense possibly damaging 0.57
R3881:Itpr3 UTSW 17 27113840 missense probably benign 0.01
R3979:Itpr3 UTSW 17 27085131 missense probably benign 0.23
R3979:Itpr3 UTSW 17 27091572 missense probably damaging 1.00
R4224:Itpr3 UTSW 17 27107258 missense probably damaging 1.00
R4259:Itpr3 UTSW 17 27106324 missense probably damaging 1.00
R4321:Itpr3 UTSW 17 27111974 missense probably benign 0.00
R4466:Itpr3 UTSW 17 27106342 missense probably damaging 1.00
R4493:Itpr3 UTSW 17 27104612 missense probably damaging 1.00
R4597:Itpr3 UTSW 17 27093283 missense probably damaging 1.00
R4823:Itpr3 UTSW 17 27085147 missense probably benign 0.30
R4921:Itpr3 UTSW 17 27098005 missense probably damaging 1.00
R4974:Itpr3 UTSW 17 27083608 missense probably damaging 0.96
R5063:Itpr3 UTSW 17 27089911 missense possibly damaging 0.94
R5079:Itpr3 UTSW 17 27098423 missense probably damaging 1.00
R5303:Itpr3 UTSW 17 27116689 missense probably benign 0.38
R5518:Itpr3 UTSW 17 27087592 missense probably damaging 1.00
R5521:Itpr3 UTSW 17 27107334 missense probably benign 0.09
R5566:Itpr3 UTSW 17 27115952 missense possibly damaging 0.71
R5567:Itpr3 UTSW 17 27103906 missense possibly damaging 0.66
R5579:Itpr3 UTSW 17 27113519 missense probably damaging 1.00
R5610:Itpr3 UTSW 17 27118566 missense probably benign 0.42
R5658:Itpr3 UTSW 17 27107878 missense possibly damaging 0.74
R5856:Itpr3 UTSW 17 27106405 missense probably damaging 1.00
R5872:Itpr3 UTSW 17 27086976 missense probably benign 0.02
R5878:Itpr3 UTSW 17 27110862 missense probably benign 0.01
R5889:Itpr3 UTSW 17 27115065 missense probably damaging 0.99
R5907:Itpr3 UTSW 17 27117893 missense probably damaging 1.00
R5930:Itpr3 UTSW 17 27110921 missense possibly damaging 0.49
R5987:Itpr3 UTSW 17 27104601 missense probably damaging 1.00
R6029:Itpr3 UTSW 17 27098171 missense probably damaging 1.00
R6195:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6213:Itpr3 UTSW 17 27111200 missense probably benign 0.03
R6233:Itpr3 UTSW 17 27086960 missense probably damaging 0.97
R6376:Itpr3 UTSW 17 27095475 missense possibly damaging 0.94
R6514:Itpr3 UTSW 17 27091370 missense probably benign
R6515:Itpr3 UTSW 17 27091370 missense probably benign
R6516:Itpr3 UTSW 17 27091370 missense probably benign
R6955:Itpr3 UTSW 17 27121467 missense probably damaging 1.00
R7002:Itpr3 UTSW 17 27110580 missense probably benign 0.00
R7064:Itpr3 UTSW 17 27089295 missense probably damaging 1.00
R7257:Itpr3 UTSW 17 27118561 missense probably benign 0.00
R7469:Itpr3 UTSW 17 27121054 missense possibly damaging 0.74
V7732:Itpr3 UTSW 17 27111024 splice site probably benign
V7732:Itpr3 UTSW 17 27111026 splice site probably null
Z1088:Itpr3 UTSW 17 27113528 missense possibly damaging 0.50
Z31818:Itpr3 UTSW 17 27095478 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGAAGCGTTGGTCCTCAC -3'
(R):5'- CGCGTTGAGATTGGAATCATAG -3'

Sequencing Primer
(F):5'- TCCTCACCAGGGCCATG -3'
(R):5'- AGGCATGAGGGTCCCCATG -3'
Posted On2014-09-17