Incidental Mutation 'R2069:Olfr714'
ID226943
Institutional Source Beutler Lab
Gene Symbol Olfr714
Ensembl Gene ENSMUSG00000049674
Gene Nameolfactory receptor 714
SynonymsGA_x6K02T2PBJ9-9453401-9454354, P4, MOR263-2
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107070981-107077802 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 107074619 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 264 (K264*)
Ref Sequence ENSEMBL: ENSMUSP00000151106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054629] [ENSMUST00000214429]
Predicted Effect probably null
Transcript: ENSMUST00000054629
AA Change: K264*
SMART Domains Protein: ENSMUSP00000095742
Gene: ENSMUSG00000049674
AA Change: K264*

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.5e-56 PFAM
Pfam:7tm_1 42 291 3.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214123
Predicted Effect probably null
Transcript: ENSMUST00000214429
AA Change: K264*
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Olfr714
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Olfr714 APN 7 107074493 missense probably damaging 0.98
IGL02562:Olfr714 APN 7 107074562 missense probably benign 0.03
IGL02597:Olfr714 APN 7 107074439 missense possibly damaging 0.89
IGL02598:Olfr714 APN 7 107074716 missense possibly damaging 0.64
IGL02981:Olfr714 APN 7 107074551 missense probably damaging 1.00
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0064:Olfr714 UTSW 7 107074280 missense probably benign 0.02
R0518:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R0521:Olfr714 UTSW 7 107074758 missense possibly damaging 0.81
R1661:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R1665:Olfr714 UTSW 7 107074274 missense probably damaging 1.00
R2202:Olfr714 UTSW 7 107074316 missense probably damaging 1.00
R3884:Olfr714 UTSW 7 107073903 missense possibly damaging 0.72
R4362:Olfr714 UTSW 7 107074592 missense probably damaging 0.99
R4618:Olfr714 UTSW 7 107074554 missense probably damaging 1.00
R5375:Olfr714 UTSW 7 107073873 missense probably benign 0.05
R5654:Olfr714 UTSW 7 107074187 missense probably damaging 1.00
R6228:Olfr714 UTSW 7 107074136 missense probably damaging 1.00
R7196:Olfr714 UTSW 7 107074728 missense probably benign 0.01
R7202:Olfr714 UTSW 7 107074241 missense probably benign 0.01
R7232:Olfr714 UTSW 7 107073855 missense probably benign 0.03
Z1088:Olfr714 UTSW 7 107074405 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GTTGTCATGATACCCTGCCTG -3'
(R):5'- TGGGAGCTGGAATTCATTACAATAGAG -3'

Sequencing Primer
(F):5'- ATGATACCCTGCCTGCTGATC -3'
(R):5'- GAGATCAATGGGTAGATATGAACAAC -3'
Posted On2014-09-17