Incidental Mutation 'R2069:Ltbp2'
ID226975
Institutional Source Beutler Lab
Gene Symbol Ltbp2
Ensembl Gene ENSMUSG00000002020
Gene Namelatent transforming growth factor beta binding protein 2
Synonyms
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84783212-84876532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84793733 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 1000 (C1000G)
Ref Sequence ENSEMBL: ENSMUSP00000127693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002073] [ENSMUST00000110254] [ENSMUST00000163189] [ENSMUST00000166383]
Predicted Effect probably damaging
Transcript: ENSMUST00000002073
AA Change: C1043G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002073
Gene: ENSMUSG00000002020
AA Change: C1043G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 546 582 3.8e-9 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 666 707 3.4e-17 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 917 1.75e-10 SMART
EGF_CA 918 957 1.53e-10 SMART
EGF_CA 958 997 3.51e-10 SMART
EGF_CA 998 1038 8.3e-12 SMART
EGF_CA 1039 1080 4.56e-9 SMART
EGF_CA 1081 1122 4.56e-9 SMART
EGF_CA 1123 1163 8.76e-11 SMART
EGF_CA 1164 1205 4.38e-11 SMART
EGF_CA 1206 1246 1.75e-10 SMART
EGF_CA 1247 1290 2.24e-8 SMART
EGF_CA 1291 1332 6.01e-9 SMART
EGF 1336 1375 1.95e1 SMART
Pfam:TB 1410 1450 1.4e-13 PFAM
EGF_CA 1473 1515 2.31e-10 SMART
EGF_CA 1516 1555 7.93e-9 SMART
Pfam:TB 1582 1623 1e-13 PFAM
low complexity region 1691 1704 N/A INTRINSIC
EGF 1724 1761 4e-5 SMART
EGF_CA 1762 1806 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110254
AA Change: C1020G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105883
Gene: ENSMUSG00000002020
AA Change: C1020G

DomainStartEndE-ValueType
low complexity region 119 128 N/A INTRINSIC
EGF 204 233 6.55e-1 SMART
low complexity region 275 295 N/A INTRINSIC
EGF 404 433 8.19e-2 SMART
low complexity region 535 546 N/A INTRINSIC
Pfam:TB 565 602 4e-8 PFAM
EGF_CA 626 666 8.05e-10 SMART
Pfam:TB 685 727 3.7e-16 PFAM
EGF_CA 852 894 7.18e-7 SMART
EGF_CA 895 934 1.53e-10 SMART
EGF_CA 935 974 3.51e-10 SMART
EGF_CA 975 1015 8.3e-12 SMART
EGF_CA 1016 1057 4.56e-9 SMART
EGF_CA 1058 1099 4.56e-9 SMART
EGF_CA 1100 1140 8.76e-11 SMART
EGF_CA 1141 1182 4.38e-11 SMART
EGF_CA 1183 1223 1.75e-10 SMART
EGF_CA 1224 1267 2.24e-8 SMART
EGF_CA 1268 1309 6.01e-9 SMART
EGF 1313 1352 1.95e1 SMART
Pfam:TB 1387 1427 1.4e-11 PFAM
EGF_CA 1450 1492 2.31e-10 SMART
EGF_CA 1493 1532 7.93e-9 SMART
Pfam:TB 1558 1600 4.6e-13 PFAM
low complexity region 1668 1681 N/A INTRINSIC
EGF 1701 1738 4e-5 SMART
EGF_CA 1739 1783 1.91e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163189
AA Change: C1000G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127693
Gene: ENSMUSG00000002020
AA Change: C1000G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
EGF 184 213 6.55e-1 SMART
low complexity region 255 275 N/A INTRINSIC
EGF 384 413 8.19e-2 SMART
low complexity region 515 526 N/A INTRINSIC
Pfam:TB 545 582 4e-8 PFAM
EGF_CA 606 646 8.05e-10 SMART
Pfam:TB 665 707 3.8e-16 PFAM
EGF_CA 832 874 7.18e-7 SMART
EGF_CA 875 914 1.53e-10 SMART
EGF_CA 915 954 3.51e-10 SMART
EGF_CA 955 995 8.3e-12 SMART
EGF_CA 996 1037 4.56e-9 SMART
EGF_CA 1038 1079 4.56e-9 SMART
EGF_CA 1080 1120 8.76e-11 SMART
EGF_CA 1121 1162 4.38e-11 SMART
EGF_CA 1163 1203 1.75e-10 SMART
EGF_CA 1204 1247 2.24e-8 SMART
EGF_CA 1248 1289 6.01e-9 SMART
EGF 1293 1332 1.95e1 SMART
Pfam:TB 1367 1407 1.5e-11 PFAM
EGF_CA 1430 1472 2.31e-10 SMART
EGF_CA 1473 1512 7.93e-9 SMART
Pfam:TB 1538 1580 4.7e-13 PFAM
low complexity region 1648 1661 N/A INTRINSIC
EGF 1681 1718 4e-5 SMART
EGF_CA 1719 1763 1.91e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163214
SMART Domains Protein: ENSMUSP00000132067
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF_CA 6 46 8.76e-11 SMART
EGF_CA 47 90 2.24e-8 SMART
EGF_CA 91 132 6.01e-9 SMART
EGF 136 175 1.95e1 SMART
Pfam:TB 210 250 1.5e-14 PFAM
EGF 276 307 1.5e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000165141
AA Change: C116G
SMART Domains Protein: ENSMUSP00000132690
Gene: ENSMUSG00000002020
AA Change: C116G

DomainStartEndE-ValueType
EGF 1 31 1.2e1 SMART
EGF_CA 32 71 3.51e-10 SMART
EGF_CA 72 112 8.3e-12 SMART
EGF_CA 113 154 4.56e-9 SMART
EGF_like 155 183 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166383
SMART Domains Protein: ENSMUSP00000127255
Gene: ENSMUSG00000002020

DomainStartEndE-ValueType
EGF_CA 8 49 2.13e-9 SMART
Pfam:TB 75 117 1.3e-14 PFAM
low complexity region 185 198 N/A INTRINSIC
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent transforming growth factor (TGF)-beta binding proteins (LTBP), which are extracellular matrix proteins with multi-domain structure. This protein is the largest member of the LTBP family possessing unique regions and with most similarity to the fibrillins. It has thus been suggested that it may have multiple functions: as a member of the TGF-beta latent complex, as a structural component of microfibrils, and a role in cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit early embryonic lethality prior to E6.5. Mice homozygous for a different null allele are viable, fertile, and developmentally normal but develop lens dislocations due to ciliary zonule fragmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Ltbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Ltbp2 APN 12 84791064 missense probably damaging 1.00
IGL00938:Ltbp2 APN 12 84831799 missense probably benign 0.03
IGL01397:Ltbp2 APN 12 84790268 missense probably damaging 1.00
IGL01570:Ltbp2 APN 12 84794033 missense probably benign 0.05
IGL01631:Ltbp2 APN 12 84809146 critical splice donor site probably null
IGL01662:Ltbp2 APN 12 84809246 missense probably benign 0.00
IGL01728:Ltbp2 APN 12 84791009 missense probably damaging 0.99
IGL01839:Ltbp2 APN 12 84793658 missense possibly damaging 0.48
IGL01946:Ltbp2 APN 12 84830748 missense probably damaging 1.00
IGL01977:Ltbp2 APN 12 84830199 missense probably damaging 1.00
IGL02220:Ltbp2 APN 12 84829309 missense possibly damaging 0.93
IGL02340:Ltbp2 APN 12 84792955 critical splice donor site probably null
IGL02430:Ltbp2 APN 12 84799401 missense probably damaging 1.00
IGL02492:Ltbp2 APN 12 84809665 missense probably damaging 1.00
IGL02517:Ltbp2 APN 12 84785317 missense probably benign 0.42
IGL02794:Ltbp2 APN 12 84791935 missense probably damaging 1.00
deft UTSW 12 84853912 missense probably damaging 0.98
R0045:Ltbp2 UTSW 12 84809587 missense probably damaging 1.00
R0045:Ltbp2 UTSW 12 84813288 missense probably damaging 1.00
R0091:Ltbp2 UTSW 12 84793733 missense probably damaging 1.00
R0094:Ltbp2 UTSW 12 84799426 missense probably damaging 1.00
R0166:Ltbp2 UTSW 12 84786358 missense probably benign 0.28
R0265:Ltbp2 UTSW 12 84785969 splice site probably null
R0394:Ltbp2 UTSW 12 84806424 splice site probably benign
R0535:Ltbp2 UTSW 12 84784858 missense probably damaging 1.00
R0535:Ltbp2 UTSW 12 84791052 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1465:Ltbp2 UTSW 12 84813300 missense probably damaging 1.00
R1513:Ltbp2 UTSW 12 84791944 missense probably damaging 1.00
R1858:Ltbp2 UTSW 12 84830781 nonsense probably null
R1880:Ltbp2 UTSW 12 84829271 missense probably benign 0.45
R1894:Ltbp2 UTSW 12 84787961 missense probably damaging 1.00
R1900:Ltbp2 UTSW 12 84830658 missense probably damaging 1.00
R1903:Ltbp2 UTSW 12 84830105 missense probably benign 0.01
R1912:Ltbp2 UTSW 12 84785863 missense probably damaging 0.98
R1993:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R1995:Ltbp2 UTSW 12 84808446 critical splice acceptor site probably null
R2126:Ltbp2 UTSW 12 84785709 unclassified probably null
R2139:Ltbp2 UTSW 12 84815979 missense probably damaging 1.00
R2341:Ltbp2 UTSW 12 84809163 missense probably benign 0.08
R2511:Ltbp2 UTSW 12 84804409 synonymous probably null
R3737:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3738:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3739:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R3889:Ltbp2 UTSW 12 84784907 unclassified probably benign
R4034:Ltbp2 UTSW 12 84804474 missense probably damaging 1.00
R4542:Ltbp2 UTSW 12 84831819 nonsense probably null
R4621:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4623:Ltbp2 UTSW 12 84809348 missense probably damaging 1.00
R4831:Ltbp2 UTSW 12 84793640 missense possibly damaging 0.55
R5080:Ltbp2 UTSW 12 84803864 missense probably damaging 1.00
R5116:Ltbp2 UTSW 12 84809737 missense probably damaging 1.00
R5351:Ltbp2 UTSW 12 84790358 missense possibly damaging 0.95
R5445:Ltbp2 UTSW 12 84809654 missense probably null 1.00
R5608:Ltbp2 UTSW 12 84787464 intron probably null
R5784:Ltbp2 UTSW 12 84868739 missense probably damaging 1.00
R5838:Ltbp2 UTSW 12 84789101 missense probably benign 0.16
R5859:Ltbp2 UTSW 12 84794063 missense possibly damaging 0.52
R6004:Ltbp2 UTSW 12 84876149 missense probably benign 0.00
R6028:Ltbp2 UTSW 12 84784852 missense probably damaging 1.00
R6347:Ltbp2 UTSW 12 84853912 missense probably damaging 0.98
R6615:Ltbp2 UTSW 12 84813317 missense probably damaging 1.00
R6636:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6637:Ltbp2 UTSW 12 84875838 missense probably benign 0.00
R6755:Ltbp2 UTSW 12 84795073 missense probably damaging 1.00
R6759:Ltbp2 UTSW 12 84787410 missense probably damaging 0.99
R6806:Ltbp2 UTSW 12 84809238 missense possibly damaging 0.74
R6968:Ltbp2 UTSW 12 84789083 critical splice donor site probably null
R7084:Ltbp2 UTSW 12 84868685 missense probably damaging 1.00
R7250:Ltbp2 UTSW 12 84787392 nonsense probably null
R7374:Ltbp2 UTSW 12 84830175 missense probably damaging 1.00
X0017:Ltbp2 UTSW 12 84828528 missense probably damaging 1.00
X0026:Ltbp2 UTSW 12 84830199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGACTCAGGATCAGCCCAAG -3'
(R):5'- CTTGGCGCATGCAAATCAAG -3'

Sequencing Primer
(F):5'- CTGGAGACAAACAGATGCTATTTAAG -3'
(R):5'- GCAAATCAAGTCTGCAGCATCTTTC -3'
Posted On2014-09-17