Incidental Mutation 'R2070:Med12l'
ID227021
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 040075-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59244905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1037 (D1037G)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040325
AA Change: D1002G

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: D1002G

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164225
AA Change: D1037G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: D1037G

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199659
AA Change: D1037G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: D1037G

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense not run
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense not run
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACTTAGCATGTCTGTAAGTG -3'
(R):5'- CCAAAGCCATGATTTCTCAGGC -3'

Sequencing Primer
(F):5'- CACTTAGCATGTCTGTAAGTGAAGTG -3'
(R):5'- AGCCATGATTTCTCAGGCTAAGTG -3'
Posted On2014-09-17