Incidental Mutation 'R2070:B3gnt4'
ID227041
Institutional Source Beutler Lab
Gene Symbol B3gnt4
Ensembl Gene ENSMUSG00000029431
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Synonyms
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123510460-123511882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123511370 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 266 (H266L)
Ref Sequence ENSEMBL: ENSMUSP00000031384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031384] [ENSMUST00000094327] [ENSMUST00000111586] [ENSMUST00000111587] [ENSMUST00000121444] [ENSMUST00000125652] [ENSMUST00000139398] [ENSMUST00000145152] [ENSMUST00000196809] [ENSMUST00000197682] [ENSMUST00000200247]
Predicted Effect probably benign
Transcript: ENSMUST00000031384
AA Change: H266L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031384
Gene: ENSMUSG00000029431
AA Change: H266L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Galactosyl_T 106 297 1.3e-43 PFAM
Pfam:Fringe 169 302 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094327
SMART Domains Protein: ENSMUSP00000091885
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 3e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111586
SMART Domains Protein: ENSMUSP00000107213
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 174 7.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111587
SMART Domains Protein: ENSMUSP00000107214
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 237 4.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121444
SMART Domains Protein: ENSMUSP00000113933
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 4e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 530 558 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125652
SMART Domains Protein: ENSMUSP00000115045
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 237 1.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134552
Predicted Effect probably benign
Transcript: ENSMUST00000139398
SMART Domains Protein: ENSMUSP00000143485
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 150 7.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145152
SMART Domains Protein: ENSMUSP00000143617
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 150 3.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196809
SMART Domains Protein: ENSMUSP00000143602
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 2e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 635 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197682
Predicted Effect probably benign
Transcript: ENSMUST00000200247
SMART Domains Protein: ENSMUSP00000143673
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 1 109 4.4e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in B3gnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:B3gnt4 APN 5 123511068 missense probably damaging 1.00
IGL01791:B3gnt4 APN 5 123511099 missense probably damaging 1.00
IGL02825:B3gnt4 APN 5 123511051 missense possibly damaging 0.58
R1996:B3gnt4 UTSW 5 123511339 missense probably damaging 1.00
R2071:B3gnt4 UTSW 5 123511370 missense probably benign 0.00
R2254:B3gnt4 UTSW 5 123511279 missense probably damaging 0.99
R2255:B3gnt4 UTSW 5 123511279 missense probably damaging 0.99
R3153:B3gnt4 UTSW 5 123510653 missense probably benign 0.00
R3608:B3gnt4 UTSW 5 123510775 missense probably damaging 1.00
R5021:B3gnt4 UTSW 5 123510947 missense probably damaging 0.98
R6438:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
R6496:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAATGTGCTCGAGTTCTTGG -3'
(R):5'- ACATGGTCCACATCTCCAGG -3'

Sequencing Primer
(F):5'- CTTGGAGGGCTGGGATCC -3'
(R):5'- ATCTCCAGGGGGCTGAGAC -3'
Posted On2014-09-17