Incidental Mutation 'R2070:Slitrk5'
ID227084
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission 040075-MU
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111680189 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 415 (Y415C)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably damaging
Transcript: ENSMUST00000042767
AA Change: Y415C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: Y415C

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111680689 missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6230:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111680294 missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111680836 missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACTTCTAGGCAGCCCTCTAAAG -3'
(R):5'- AGAATAATTCTGGGCTCAGCC -3'

Sequencing Primer
(F):5'- ACTTGGGCTACAGTAACTATGGCC -3'
(R):5'- GGCTCAGCCTCTCAATCCTG -3'
Posted On2014-09-17